Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9191  (registered. 2002)
Contig Information
Length 610 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative exported uslfatase [Lentisphaera araneosa HTCC2155] >gi|149136625|gb|EDM25057.1| putative exported uslfatase [Lentisphaera araneosa HTCC2155]
Score 78
Evalue 4.99578
Total Hit Count 2
Registered year 2002
Contig Sequence     [ Download ]
>Contig9191
gaggcTCAAAG*CAACGAGCGAGCCAGCACTTTCTGCTCAGATCACCCGATGGGTTCCAGGTCCTGCTCCTACGTCTTCTTGCTCGGCCTTTGCTCCCTG
CTGCTAGTGGTGCTTTCAGGCCAGCGCACGCTAG*CTCGAGACACTCCCGTGTCCACAGCAACGGCCTTGGCTCCATTTGTTCATGCGCCTGCCAAGGGC
GACGCCGGCGGCCACCGTGCTGATGTGGATAAGCCTCGAGTATCGGATGAGAAGCCAACAATAACCGGAATAATCTGGAGGCCCGTGCCTAAGATCCACT
GCCCGTCCATCTTTTGCGGTACCAAGGCTGCCACTGCCACTGCCCCTGCGGCAACGGCACATCCATGACAAGAAGAAGATAGAGTGGTGGTTCGCAATGT
AATCATATGCATGTTTTCCTACCCTGGTTTTAGTAATTTAGATATATATGTATGTGTTCCACGAGTGTTGCAGCGTGCCTGCAAAGGCCTCTCGATGGAT
ACTAGTAGTGCTATGGTAGCACGGTCGGGTTGTAGTTTCATTCATTGTATCTGTCGATCATGCAATTGGTTGCTGT*CTCTCGGTCctttttttgttgtt
aaaaaaaaaa
page-top