Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9033  (registered. 2002)
Contig Information
Length 553 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_f Spike at flowering date 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0101600 [Oryza sativa (japonica cultivar-group)] >gi|113547126|dbj|BAF10569.1| Os03g0101600 [Oryza sativa (japonica cultivar-group)] >gi|218191901|gb|EEC74328.1| hypothetical protein OsI_09616 [Oryza sativa Indica Group]
Score 485
Evalue 2.46108e-47
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig9033
agggtctTCTCCTCCCCCTCCCCTgctcgCTAct*cctGTCGCCGTCACTCCCCGCCGCTCCAACTCGCACCCCGCTGCCCGCCTCCACCTCCGCCTCCG
CCTCCGCTGCTGCTGCTCCGCCAGCGATCCGGCGCCGATGGTGAAGGCCATCAGGGTCCACGAGCTCGGCGGCCCCGAGGCGCTGCGGTGGGAGGATGTG
GAGGTGGGCGAGCCCGGGGACGGCGAGATCCGGATCCGGAACACCGCCATCGGCGTCAACTTCATCGACGTCTACTTCCGCAAGGGCGTCTACCCCGCTC
CCCTCCCCTTCACCCCCGGCATGGAAGCTGTTGGCGTGGTGACTGCCGTGGGGCCCGGACTGACCGGCAGGAAAGTCGGGGATGTTGTCGCGTACGCAGG
CAAGCCTATGGGCTCTTATGCTGAAGAGCAGATTATTCCAGCCGATgtcgcTGTTCCTGtcccaccttcagtaaatcacaagacagcggctgccatcatg
ctcaaggggatgactgttcatatgctagttcgccgcatatttaaggttgagac
page-top