Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4614  (registered. 2012)
Contig Information
Length 848 bp
Clones alternative view 54 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 8
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 2
Wh_VHS Shoot with heat shock treatment 2
WH_XN Leaves, plant was grown at constant 23℃ 4
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|66840992|emb|CAI64395.1|| putative high mobility group protein [Triticum aestivum]
Score 216
Evalue 2.00E-54
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4614
ACGAGGCGCATTCTCCCCCTTTCGTTGTCCTTCCCCGTCCCCATTCCCTCCGCTCCCCAGTCCGCAGCAGTTCCGCACCGACGCCCTCCTCACCCTCCCC
AAAGCCCTAACCGCTCGCCCGCTCCGCCGCCATGAGGTCCAAGGCCAACGGAGACACCGCGTTCAAGGCCTCCGGCAAGAACAAGACGGCCACCGGCGGC
GTCGCCAAGCCGAAGCGCGCCCCCACCCCTTTCTTCGCTTTCCTGGCTGAGTTCAGGCCACAGTACATGGAGAAGCACCCCGAGGCAAAGGGCGTCGCGG
CCGTTACCAAGGCGGCCGGGGAGAAGTGGCGCAGCATGTCGGATGAGGAGAAGGCAAAGTATGGCGGCAAGAAGGCAGATGCCCCAGCAAGCAAGGTGGT
GAACAAGAAGGAGAGCACCAGCTCCAAGAAGGCCAAGACTGACGCTGACGAAGAAGGTTCTGACGTTGAGGATGATGCCGAGGAGGACGAGGAGTAAATA
GTAGATGAGGGAACAGCAGCGGTGCAAATCAGCGTTTGCTGCTTAGGGTTTAGCTTGCCATGTCGATGTCCGGATTATGTAATGTTATGTAAGGAGAATG
TTTAGATGCGTGCTCCTGGGCTGTGGCATGCTGGAGATGTCTCTGTTTGACTAGTAGCGAAGAAAAGCTTAAAACCCTTACTGCTTTTCTTTCGTGGACC
TCCACAGCATGTGGAAACAGTTATTATGCTTGCTTTTATCTACTGATCTGATGACTAGCCTGCTGTTGGCTTGCTATTAATTGCTTTATGTCTTGTGTTC
GCCTTTCACTTTCTTATTGCTTCTCATTTTCCTGCTGCACTGCTCTCG
page-top