Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8986  (registered. 2002)
Contig Information
Length 690 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Rpr4901.2 [Hordeum vulgare subsp. vulgare]
Score 326
Evalue 1.16206e-28
Total Hit Count 14
Registered year 2002
Contig Sequence     [ Download ]
>Contig8986
gctccatttctctattatctctctccctctcgcgctcctaccgaagtgtactaccaagtagcagcgacctgattatatagcacggcaggccggtcgtcGC
CTCGTCTCGCCGGG*AG*AGGATAGGCACAGGCGAGCACAG*AGAGAGGGAAGCAGCTGATCCCAGCCGGAGAACCGTCCATCCGCCATGAGCGACGGCC
AGGGCAATGCTCCTCCTGGAGGCTACTTCATCGGCCGTCCGGTAAACACCGACGAGACCAAGGAGAAAGAACCGCCGCAGGCCGTCCCTGAGCCTGCTCC
AGCTGCGCTGAATACCCCTGGTGATTACTTCGTCGGCCGCCCGTCGAACCACGAGCAGAACACGGCAGCGCCGCCGGCTAAACCGAGCTTCTTGGCCAAA
TTCTGTCCATGCCTCGCCGGCGGTGGAGCTACCAGCTAGACCGACCGGCCCAGCAGCCGTGCGCCGTGCGCGTGACCACGGGAGGATTTGAAGTGGAATC
TCAATTCTGTATTGGAACTGTGCGAGGTCTCTTCATCTTTGGAAGCTCTGCTCTGTTTTTCCTTCTTTCTCTAGCATTTGATTCCTGCGTATTcatttcG
TGTAATGCCGACAAACGTAAACTCGACGAAACTGCAATCCGTCCAtgtgaaatgaaaatgatgttgatttgttcaattgtaaaaaaaaaa
page-top