Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8905  (registered. 2002)
Contig Information
Length 597 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18069 [Oryza sativa Indica Group]
Score 363
Evalue 8.61342e-38
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig8905
gttaacctgcaattgctaggtaaactccggacgcacaacacagtgacacactgacgacacatactaatTAAGTTCCACTTGCTCTGCATCAGGCATTTTT
AGTTGGCTTTACTACATCCAAACCCCAAAATATGACTGGCTGACACCGCCCCTTGCATCTATCTACAATCATCATAAGGCAACAAACTCTGCGCCCTGTT
CCTGCCAACACTCTTCTTCCACCGCTCTTGACCGAATGCAAATCCCTCTAGTTCCGACTTGCACTTGCCCTAGTCCTCTTCCTTGAATTCTTCGGACCGC
CGCCGCGACAGTACTTGC*TTCCACACATGCAGTCAAATGCTTTATTGAGGTCATcaagtACCATCAAAATCAATGCCATAATCCcgtgtTAACTCCTCA
AAAGCCTCTATTTTCTTGGCAGTGAATAATGCAAGATGGTAATAATGGCGATCAGGAGTCtcaacTTCAACAGGTATGATTACCAAATTTGCATCATAGC
ATCTATGGTTGACAAATCGCCCGACATTCCCATAAAATGtcggaTCAAGgcagagagcttcctcgtctcttagcaccccttcagaaccccaactagc
page-top