Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8809  (registered. 2002)
Contig Information
Length 554 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit translation initiation factor eIF5 [Triticum aestivum]
Score 514
Evalue 1.0866e-50
Total Hit Count 311
Registered year 2002
Contig Sequence     [ Download ]
>Contig8809
tttgatgcaaccgaccagacatactaTAGTTCGTTTAACTGACTCGATACAGAAATAACCAAAAACTCAATGGTGTAAACAACAGGCAAATACGAAAAGT
GGAAAGACAAAGACTGACACTTATAGAACACTCATCAAAGACACTCGGTAGTAGGGTGGTAGGGAATCGCAGTACTGCCTCTCACTCCTCATCGTCAGAT
TCGGCGCTCTGGAGCCACTCCACGACCGGCTTGGCGTTCTTCACGACCTGGGAGTTCTTGCCGGCAGCAACAGCTTCATTGTACCACTGGACAATGGTTT
CTTCCTCGAGGACGTCTCCATCATAGAGGGCCTTCAGGACGACGGGGACTTCCTTCAGGGCTTCAGCac*tgCACTTGCCACAGAACGCCTCTATAGCCT
GGAGCAGGAGCATCTGGGACCCTTCATCAGGCACCGCAGTGGAAAGGTACTTCTTGTTCTTCACCACTTCCTTCGCAAACCCCTTGCCCACGCCATGGAA
GAGTGCCTCGAAGAGAGCATGCATCACGTCCTTGGGGGGTAGGGCCGAGGAGgc
page-top