Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4594  (registered. 2012)
Contig Information
Length 570 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226506726|ref|NP_001141599.1|| hypothetical protein LOC100273717 [Zea mays]
Score 259
Evalue 1.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4594
AAATCGCTCGCTCGAACCCTATCCTCTCCTCCCCTCCCCTCCCCTCCCCGCAGCCGCAGGCACCCAAAACCCTAGCGCCGCCGCGCCGGATCTTTCTCTG
CAGCTCGCCCCTCCCCCCCCTACCTGCCGGATCCATCCATCCATCCATCCATGATGGGAGAGGCCAAGGAGAACGACGTGTACGAGGAGGAGCTGCTCGA
CTACGAGGAGGACGACGACAAGGCCCTCGACGCCTCCTCCGCCAAGCCCGCCGCCGACGCCGCCCAGGCCAAGAAGGGCTACGTCGGCATCCACAGCTCC
GGATTCCGCGACTTCCTCCTCAAGCCCGAGCTGCTCCGGGCCATCCAGGACTGCGGATTCGAGCACCCCTCCGAAGTGCAACATGAGTGCATCCCTCAAG
CAATCCTCGGAATGGATGTCATCTGCCAAGCAAAATCTGGGATGGGGAAGACTGCTGTCTTTGTCCTGTCGTCTCTCCAGCAGATCGATCCTACTGCTGG
TCAGGTGGCAGCGCTCGTATTGTGCCACACCAGAGAGCTGGCTTACCAGATTTGCAACGAGTTCGAGAGG
page-top