Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8650  (registered. 2002)
Contig Information
Length 1077 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_03454 [Oryza sativa Indica Group]
Score 726
Evalue 1.06015e-74
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig8650
gcggcgaggagcacgggaagGGAGGCGGAACTcggg*agAGGAGATGGGTGCGCCGAAGCAGAAGTGGACGTCGGAGGAGGAGGAGGCGCTGCGGCGCGG
CGTGCTCAAGCACGGCGCTGGCAAGTGGCGCACCATCCAGAAGGATCCCGAGTTCAGCCCCGTCCTCTCCTCCCGCTCCAACATCGACCTCAAGGACAAA
TGGAGGAATTTGAGTTTTAGTGCAAGTGGACTGGGTTCAAGGGATAAACTAAGGGTTCCGAGGCCGAAAGCACCTTCGTCCTCCCCATCACCTAGCCCGC
AGCTTCTGCTTCTCTCAGCCCCGAATAATGTTGCCGAGGCTTCTCCACCAGAAGATTGTGAAAAAAGCCCACAGGATGACAAGACTCCGAGTCCAAAGTT
gtacagttccatgatcctggaagctctcgacgaactgaaagagccaaatggttcagaagttgctacaatttgCAATTTCATAGAGCAAAGGCATGAGGTG
caaccaAATTTTAGAAGGTTGCTTTGTGCCAAATTACGAAGGCTTATAGGCGTGAACAAAGTTGAGAAGATTGATAAGTCCTATAAGCTGACGGATTCAT
ATGCAAAAAGGGCTCTGGCTCCAATGAAAGATCCATCTCtaaagaagaaggattcagccaagtcatccaaggcagcaaagggtctaggccagtcgagtcc
tgcactggacgcagctgaagctgcagcgatgaaagtagcggacgcggaggccaaatcgcacctcgcaaacgagcacatgatggaggttgaaaggatcggc
aagatggccgaggagaccgagtctctcctcgagctcgcctcagagctctacgagcgatgttcaagaggagaggcgctcacaatactgcaagtggcgcaca
gggagttttgatggtgttgtcgaccccgtcagctgcgcgccgacatctgctctcttgtacatggatggatggaagcgttggcccagcctgttgtcttctt
gtccgcgtgttgtctctgttgtatcatactcgaatcaattcgtggtgtacctagagggcagcctttcatgcctagga
page-top