Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8648  (registered. 2002)
Contig Information
Length 867 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_002319 [Oryza sativa (japonica cultivar-group)]
Score 778
Evalue 1.52565e-86
Total Hit Count 47
Registered year 2002
Contig Sequence     [ Download ]
>Contig8648
gctctaccgcttcctcccccgccgcagccctgcacctggaggctgcctgcttctcctgccgaccactcccgcaagtcgcagccaagtgactgaaattcct
ggagaaacttctgttcttgatgctgttagaattttatctgagcacaacataagggcagcgccaGTGCTTAACCCTGAACCTGGTGCTCCGGCTGATTGGC
AAGGGAGGTATCTTGGCATCATTGAGTACTCagtcaTCATCCTTTGGGTACTAGATAATGCTGATCTTGCAGCCGTAGCTCTGTCAGCTGGATCAGCAAC
TGCTGCAGGAGTTGGAATGGGGGCTGTTGGTGCAGTGGGTGTGGCAGCATTAGGTGCAACTGGCCCGGCAGCTGTCGCTGGATTGACTGCTGCTGCAGTA
GGGGCCGCTGTTGCTGGCGGGTTAACTGCTGAAAAGGGTGTTGCAAAGGATGGAGTAACTGCTGCTGATCATTTAGGGGAAGATTTCTACAAAGTTCTGC
TTCAGCAAGAACCTTTCAAATCGACTACAGTTCGGTCAATTGTTGAGTCCTACCCGTGGTCTCCTTTTGTGCCTGTTACGCTTGACAGTTCAATGCTTGC
TGTACTACTGTTGCTCTCCAAGtacagGTTGAGGAATGTCCCTGTGattgaACCTGATAAGCCAGTTATTAAGAACTTCATTACTCAGACTGGTGTTGTT
AAaggactTCAGCAGTGTAAAGGAAGGGATTGgttcgaCTATATTTCGGCActccctCTTTCAgacatgGGGCTTCCattcatgtctctTGATGaggtta
ttaccggntaacagtgatgatctaatcttagaagctttcaagtgcatgaaggataacaaaattggcg
page-top