Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8594  (registered. 2002)
Contig Information
Length 707 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Lilium longiflorum]
Score 285
Evalue 1.19178e-28
Total Hit Count 62
Registered year 2002
Contig Sequence     [ Download ]
>Contig8594
agaaatatatatctctgctaaaacaAGTGTTGGCATTTCTCCGCtgagtTAGAACACCCCGAAGGAGCGTCCGCGCACAAAACTAAATATCCTTTTACAG
TACCAAACCTTGCCAAGTTAATCTTTCACAAAATCCCTGGCATCTTCTTCATCAGACTCATCCTTCTGTACAGCCTGTTCAGCATATTCGTCAAGGGATG
CAACAGGGAAAAGGTCGCCCTCCCGATCTCGGTCTGCTTACCAAAAATGGCCCACTTGGAGCACCCGATTCCATGGCACGGCTCACCGAAGCAGCCGCGT
CATCCTACCTATTTAAAGTTTGAGAATAGGTCGAGGACGTTGCGTCCCCAATGCCTCTAATCATTGGCTTTACCTGATAGAACTCGTAATGGGCTCCAGC
TATCCTGAGGGAAACTTCGGAGGGAACCAGCTACTAGATGGTTCGATTAGTCTTTCGCCCTTATACCCAAGTCAGACGAACGATTTGCACGTCAGTATCG
CTTCGAGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGTTCACCATCTTTCGGGTCCCGACAGGCGTGCTCCAACTCGAACCCTTCAC
AGAAGATCAGGGTCGGCCAGCGGTGcggcccgtgagggcctcccgctcgtcagcttccttgcgcatcccaggtttcagaacccgtcgactcgcacgcatg
tcagacc
page-top