Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4573  (registered. 2012)
Contig Information
Length 853 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_r Root 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XB Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115470413|ref|NP_001058805.1|| Os07g0124600 [Oryza sativa (japonica cultivar-group)]
Score 292
Evalue 3.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4573
CCGGTTACATACATGCCAGCACCCATACAGAACCGAGACTGCACGACATCAAATGTTCTGATTCTGATACATTAAAAGGATTTAAGCATTGGTACAAGGC
ATGTGAGCTCAACAGCCAGTTGGAACTTGAATGTTTTCAGTCTACATGCAGTTGAAACAAGGAATGGGGGTAAGTTGATAATTTCCAATGATGTACTTGT
CAACCAAAGAATCTCAGCTCATGTCTTCACAGTTGCGACTTCCGCTGTCATCAGTGTAGAAATAATTGCCCAGAACGTCATTGTGAACCTAGCTTCATGT
ATTCAAACTTTGTAGCAATGGTAGCAGTGCTGTCAAGTTCTTGTACATCCATAGAGTCTTGGTCATTCATGTAATCCCTGCCACCATTAACGCCATACTG
AACAGAAGGTGCAGCACCCGCATAACCACTTCTGTATGCAAAACCATAGCCAGGATACATTGGGGGATATGGGCTATATACTGGACGCCTTGCCACCATG
TTTGGAACATTTGCCATGACTGCATGGTTTGGATATGCATTTGCATAGGGATTGCCTCCCATACCAAAATAGAGGCCATGATAGTAGGGATGTGTGGGAA
CAGGTTGTGGCATATAGCCATTGTAGAAACCATGTCGGTTATTGTACGGTTGGTATGTTGAACCATCAAAGCCAACAGGACCCCTTCCGCCAAAGGTTCT
TGAGCCACGACCTCGGCCATTACGGTAATACTGAGCATCCTTGGGGATAGCGATCTTTGCTTCCACCCTTGTCCCTTTCAAGTCATGAAAGCTTTGCCCC
ATCACCTTTCTCACAGCTTCCTCGGAATCAAAGGTGACAAAACCAAAACCCCT
page-top