Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8588  (registered. 2002)
Contig Information
Length 1106 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit nucleic acid binding protein [Zea mays]
Score 1096
Evalue 1.38214e-117
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig8588
gctcaagcaattaacctcattgggaagcaaggtgcttcaattaaggcaattcaggagggcacaggtgctacaataagggttatatcagtagatgatcgag
atcggcctttctatgtatctgacgatgagaggatagttgagatacagggtgaaacagagaaagttctaaaagcactgcaagcagtttctaatcatctccg
gaagtttttggttgaccatagtgtacttccattgtttgaaaagactaatgccccagtaagtcaagatcgcagtgctgaaacttggaatgatatgccacat
cattcaattgtttctacacaagtaaatcaacaacctgaagtgcgtgatgaatatgttcttccaatgaaaagggaccatttatatcttgaacgggagccgc
tggtAGAACATAACATTCATCGCTCAGGTGTGTCATTATATGGGCGAGATCCTGCCTTGTCAGCATTACGACCTTCTGGAATGCATGGTGCTGGCCCTCT
ACTTACACAGATAACACAAACCATGCAAATCCCACTTACCTATGCAGAAGATATCATAGGAGTCAAAGGAGCAAACATTGCATACATACGGGCTAACAGT
GGTGCTGTTGTCACAATTCAAGAGAGTTTGGGAAGCCCTGATGATATAACTGTTGAAATAAAGGGGACATCGTCCCAGGTACAATCTGCTCAACAGCTTA
TCCAGGACTCCCTGGCTACGCACAGAGAACCTGTGAGGAGCAGTTACCAAGGAGGATTAGATCCGTTATATAGGTCCAGCTACCCGTATGGCAGCTCGGC
CTACCCGTCATCATCGCTGCCATCTTATTCTAACATGGACGGGAGTGGATATTCATCGTCAGGTCTTGGTGGTTACGGTTCCACTTACCGCTACTAAGAT
GGTTGCTGTTTGCCATCAAGCTTGCGGCCACCCTGTCTCCACTCCTGGGTCATCGTTGTGTATGTCAGCAATAGTTGCTCTGCTGGCTTCATGTTCCTCA
GGGTGGTACTATTATAGTCGTATCGAATCGGGGTGTGTGatttagtgtctacttgatttgtagatgttcttatttcgaggaagtctgttctagtcttttt
gtgtgc
page-top