Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4572  (registered. 2012)
Contig Information
Length 1539 bp
Clones alternative view 49 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 7
Wh_EM Dormant seed with water absorption 3
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VWD Shoot grown with dessication 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 7
WH_XV Leaves, plant was grown at constant 23℃ 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218190265|gb|EEC72692.1|| hypothetical protein OsI_06267 [Oryza sativa Indica Group]
Score 746
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4572
GAATTCGGCACGAGGTGGGAAGGAAGCAAAGCAGAGCCGCGCCGCCGAGGAGGATATGGCCGAGGCCGACGACGCCGCCGCCGCCCGCCGGCGCACGGTC
ATCACGGAGTACCGCAACAAGCTCCTGAACTGCCGCGAGCTGGAGACGAGGGTCCGCACAGGTAGGGAAAACCTAAAGAAGGCGAAGAAAGATTACGATA
AAACTGAAGATGATTTGAAGTCCTTGCAGAGTGTGGGCCAAATCATTGGTGAAGTACTTCGACCATTGGACAGTGAAAGATTTATCGTCAAAGCCAGTAG
TGGCCCACGTTATGTGGTTGGCTGCAGAAGCAAAGTTGACAAAGAAAAGCTGACAGCTGCAACACGAGTTGTCCTTGACATGACAACATTAACAATAATG
CGCACTCTACCACGTGAGGTTGATCCCGTGGTCTATAACATGCTACACGAAGACCCCGGCAATGTCAGTTACTCAGCTGTAGGTGGACTGTCGGATCAAA
TAAGGGAGCTGCGGGAGTCCATCGAGTTACCTCTTATGAATCCAGAATTGTTTCTTCGTGTTGGGATTAAACCACCAAAGGGCGTTCTGCTCTATGGCCC
ACCTGGAACGGGAAAGACATTGCTTGCTAGAGCCATTGCTAGCAACATCGATGCTAACTTTTTAAAGATTGTTTCAAGTGCTATCATTGACAAATATATT
GGTGAAAGTGCACGTCTTATAAGAGAAATGTTTAACTATGCACGTGAGCATCAACCATGTATTATTTTCATGGATGAGATTGATGCCATTGGTGGCCGAA
GATTCAGTGAGGGCACTAGTGCAGATCGTGAAATACAACGGACATTGATGGAGCTCCTAAATCAGTTGGATGGATTCGATGAGCTCGGAAAGGTGAAGAT
GATCATGGCGACGAACCGGCCTGATGTCTTGGACCCTGCGCTCCTTCGTCCTGGACGCCTAGACCGGAAGATAGAGATTCCGCTGCCGAATGAGCAATCC
AGGACGGAGGTCCTGAAAATCCATGCAGCTGGTATCGCCAAGCATGGCGAAATTGATTACGAGGCTGTGGTTAAGCTGGCCGAGGGCTTCAATGGCGCTG
ATCTTCGCAATGTCTGCACTGAGGCTGGCATGGCCGCCATTCGAGCAGAGCGTGACTACGTCATCCACGAAGACTTCATGAAGGCAGTTCGGAAGTTGAA
TGACGCCAAGAAGCTCGAGTCCAGCGCACACTACAGCGCCGACTTTGGCAAGGACTAAGATGAGAGTAGGAGACTATCAGGCGACGCGCTGTCTGTTTTC
TTGTACCATGGCGGAGTTTGTCACACCGACCCCGACGATATAGAACATCATGTGTTTCTACCTTTTATATGTTGTGGGACGACTGCCTTTGCCGCGCAAG
TTGATGTAATGAAAAGTTGAAACAGGTCTGAAACCGACTGGTTTCTTAGATTTACAAAATTGTTTCCTTCAAGTTACTGTGCCTTGATTGTGGAATCAAA
AAAATGTGGAAACATTCGCGATTTCTTCCAAAAAAAAAA
page-top