Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8580  (registered. 2002)
Contig Information
Length 646 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0142500 [Oryza sativa (japonica cultivar-group)] >gi|42409328|dbj|BAD10644.1| Nucleoporin-like protein [Oryza sativa Japonica Group] >gi|113535395|dbj|BAF07778.1| Os02g0142500 [Oryza sativa (japonica cultivar-group)] >gi|125538045|gb|EAY84440.1| hypothetical protein OsI_05813 [Oryza sativa Indica Group] >gi|125580778|gb|EAZ21709.1| hypothetical protein OsJ_005192 [Oryza sativa (japonica cultivar-group)]
Score 867
Evalue 1.89665e-91
Total Hit Count 51
Registered year 2002
Contig Sequence     [ Download ]
>Contig8580
gcAGGTTTTTgttagaTTGAgtagaGAGGGGGAAGCAGGTGGAGGCCGCCAACTCACTCACGTATTACAAGAGAAGTTGCATGCTTTGTCTACTGCTATC
AACTCGTTGCAGCTTGTTGAACCCTCATGTGCCTGGCTCGATTCGATTTGTGAAGCTGATGATCAAATTTCGCCAAGCAAAAAGCCTCGTAATCTTTTGA
TGGAGAACTCTGCTTTTGGCACAGATTCAGAACTCTCTACATTGCAGTTTTGTGTTGACATTGAAATTCTTGAAAAGGAGTACACACTAACAGAAGCACT
TTATATGCTTAGTACTGTAAATTCTAAATCCAAATTTTCTGAAAGCTATTCTATCGAAGCCTTGACTGACATTCTTGTAAATGAGAATTTGTATGACCTG
GCATTCACCATCGTGCTGAAATTTTGGAAGGAGTCAGGAATGAAAAGAGAATTGGAGCGTGTCTTTGCAGCTATTGCACAGCAATGCTGCCCAAACAGAG
taggcaactcagggagaaatttgactgacactcaacagctgctacttctgccttcttccgaggatgatggatgggatggcaatagcaagactattgctgt
ggcccatcaagtgcagggaagttgccagtgggaaactcttgaacta
page-top