Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4571  (registered. 2012)
Contig Information
Length 973 bp
Clones alternative view 188 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 4
Wh_r Root 10
Wh_SH - 2
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 15
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 14
Wh_SHC Shoot grown with cold treatment 6
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 6
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 6
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 10
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_SP 2
WH_XA Root 7
WH_XB Root 8
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 18
WH_XE Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|22022400|gb|AAL47688.1|| glutathione-S-transferase 19E50 [Triticum aestivum]
Score 437
Evalue 1.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4571
AAACATCTTATTTAAGGCTTGCCAAGCGACAAATCTGAAAGCATTACGAAGACATTGTTCCATCTCAAGAGTTTTCACGACCACACACACGCAAAGCGCA
AAAACTGCACGCTGGTGCAATTCCAGCCACACACACACGAGCTCATTTGCCTTATTCGCGACACCAACAAGAAAAGAAAACGCCACACAGATCAGTGATC
GGAATCGGATCCCACGATGCGAGATCCCGCCTAGCAAATCACGGCTTCTTGGGAACCATCTGCGCGGCGAGCTTCTTCACGGCCGGCCTCGCCATGATCC
TCTCCCACCAGGCCTTGACGTGCGGGTACGAGTCGAAGAGGGCCGCGTGCGGCGTGGCCATGAAGTAGAAGGTGTAGGGGAAGTGGTTGAGGTCCGCGAA
GCTGACGAAGTCCCCGGCGAGGTAGTCGTGCTTGGACAGGCGCGCCTCGTAGACCTCCAGCACCTTCTTGAGCTTCTCCAGGCTCTCGTCCACCACCGTT
TGGTTGGTCGGCAGGCCGCGCATGAGCGGGTTGATGAGGCACTCGTACACGATCGGCGAGATGGCCGGGTTGTAGGTGTGCGCGTCCACCTCCGTCCATA
CGTCCACCATCGCCGCCTCCTTGAGGTCGCCTTCCCTCAGCAGGTCCACTTCGTTCTTCTTGTACTTGCGGAGCACGTACCTCGCAATTGCGCGTGACTC
GAAGAGAAGCAGATCCCCATCCTGGAAGGCAGGGATTTGGCCGAACGGGTTTCTGACGAGATGCTCGGGGCTCTTGTGCTCCATGGCCTTGAAATCGATG
TCGACCACCTCGTACTCGGCGCCGACCTCCTCCAGGCACACCAGCACCCGGGCCACGTTGGTCGACATCGCCGGCCCGAACACCTTCACCGGCGCCATTG
TTTCCCTTGGTTGCTAGTACACGCGAGGGAGTGAGGGATCGGGGTGTGTGTCTGTGTGTGACTGTGCTGTGTG
page-top