Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig457  (registered. 2012)
Contig Information
Length 1051 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_SH - 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115462229|ref|NP_001054714.1|| Os05g0159100 [Oryza sativa (japonica cultivar-group)]
Score 351
Evalue 9.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig457
GGCGCTTAGTCCTTAAGGGCACATGCAAGAACTCAGGCAGGTCCAGCATGTGAGGAATCATAACAGAACTGTGTCCTTTTCACAAACAAAAAAGGCCTTC
TGTATTGGAAGACATGCTTCGGACCTCTAGGCCACACCAGGGTACAAGAGAAGAAGTATGCTCTTTAGTACAGGAGAAAGTGTAAATTTACCTAGGGCTA
ATTAGTACGCTGTATTCCATCATAGTGTCACTCCAATCAAAATCGACCTACTTGGTATATAAGCCAAAATCACATGAAAACGGGATATCAGAAGCTGATC
TTCTTTGACAGATGGTACACAGTTGTATGTAATTTTGGGCCTCTGTAATCTGGACTTCAGATACCGAATGCTGACTGAAGGGATGATGTGATGCGGGATG
TGATGGCGTTTTGAGCGGCATTTTCAGCAAAAGCTCGGATGTTCTTCTTGGCATCTTTGTTGCATTTGGTGAACCCCACGATGTTTGCAAGGCTTAGAGT
CAAGCAAACTCCAACAACAAGAAGGTAATCAGCTTCAAGTCTAATGAGTGAAAATATCCCAAGAATGATCCATGCAGCAGCGTTCAAGTAAAGAGTCCAC
CAGAACAGCCACGAGTCCTTTTTGTTCATCCGAGCGAGAGACTCGCCGTCGAGGCACTCGAACTTCCACACACTGTTGCCATCATCGTCAATCTCATTCC
ACCACCGCAGCCCGACGAGTATCCTTCCGCTGACATTCTTCACCACCCAGAAGTCAAGCGCAGCGAGGAGAACGGTGATGACAAAGATGATGACGAAGCT
CTTCACGAAGAGCGAGAAGAGGATGTAGAACGCCAGCGCCGACGCCTTGAAGAGCACATGGAAGAGGCATGTTATAGGATTGGCATAGTTCTCGCTGACC
ACCTGGGGCCGATCCATGGATCCTCTTGGCTCTGCCTCCGGGACGCCTCTTTCTTCTTGCCTTGGGTGCTAAGGATGCGCCAGCTTTGGGCTTTCGTTGC
TTCCTTCGCGCGGTCGCGCCCTGGCTCTACCGAGGGGAGAAAGAGGGATCG
page-top