Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4567  (registered. 2012)
Contig Information
Length 721 bp
Clones alternative view 99 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_r Root 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_RDr Root of dessiccated seed 5
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 7
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 12
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 11
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XF Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|55296571|dbj|BAD69095.1|| putative nitrate-induced NOI protein [Oryza sativa Japonica Group]
Score 158
Evalue 5.00E-37
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4567
CAATAGGCGAGACTCAAATCACATATCAACTTCACCACTACTACTACACAAAAGGAGACCGACAAGGAGACCAGAATTACAATCAGAAGTTCACTTATCC
AAATGAGTGTCTGACAACCCTCACACCATACATACACACTTCAGAGTTTTACGAGATACCCATCGCGATATGCCCAGGGGGGCTGGGTACCTCTTACAAG
GTCTTATGGATAGTATGTATATAGCAAAATTAAACGACCATACTTTCGCAACCATTTTTTCTTCGGGCGACGCTTGTCCTCCTCAAGATTGTGTAGGACT
TGGTGTCACGCAGCAAAACCACTTCTTTGAATTTGCCTTGGTGGCATAAGATTCCACCCTCTCAGTCCTGGCATCTTTGCAAGGGGATTCGGTATCTTGT
CCATTCCCAGCCTTTTTCTCATCCCTGGCTTTGTTGAATATAACAGTGAACCCATCAGCAGAAGCTGGGTCGTTGACGTCCCATTCGCCAAACTTGGGCA
AAGGGCGACCAGATTCCTCCGACATGGATGGAGCGCGGCGGTCCGATCCGCCGAGGGGCGTGGGGAAAGTTTCGTCGGCTGCGGGTGGGAGGAAGGGGAA
AGGGACGGGGATAAGGGCGAGGAGCGAGACGGAGGGGAAGGGGGGAGGAGGAGGAGACGGCGAATCGAAGTGGAAAAGGAGCAGCAGCCGATTGACGGAT
TTATACCTCGAGACGGGGGAA
page-top