Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8502  (registered. 2002)
Contig Information
Length 724 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Oryza sativa (indica cultivar-group)] >gi|125550535|gb|EAY96244.1| hypothetical protein OsI_18142 [Oryza sativa Indica Group]
Score 438
Evalue 1.45574e-46
Total Hit Count 74
Registered year 2002
Contig Sequence     [ Download ]
>Contig8502
atctaacAAAAATGGCACTTCcaagaTCCTGAGCAATCCTAGCTAgtcaagtGCTATAaccagcCCTGGATAATCAGTCCCAAGCTATCGTTGTCATCAG
CATCTGCTTCACAAACTCGACCCTCCGCAACCGCTCCTCGAGGTCCTTCTTCGACGCATCGTCCATGACAACCTGATTCAGCCTCTGATCATCCGAGGAC
GGTGCAGCATGATCCTCCTCCTCGGCCTTGCTGGGCTCCGGATCGACGACCGGAGGCGCGACCGTGCAGATGAACTGGGAGAGCAGAGGGTCAGGTGAAT
GATCATCAGGAACCGGCTGGCCCATGATGTACGATGATTCTTCAAAGTAGGAGTCGTCCTCTTCATATGCCTCCTTGTCAGAACCTGCTGCCCCTGCTCT
GGAAGAAGACGACTTCCTCATCTTGAGTTGCTGTGAGTGCCGTTCCCTGAAATGCCCTGTCGTGTCGGCCCCGAGGTTGTCGGCGCAGATCGGGCACACA
GCATTCCTCATGTCGAAGCAGTGCTCCTCCTGCAGGTGGTCACAGAGGAAGGGgaccctCCACCTCAATGTAGCAGAAGGGGCATGGGAAGTacttcCCA
CCACTCatcctctcccgcgggagcttgatggtgagattggccatggccatggaggtgctgctgcctccctgttggcaggacgccatggcgagcctgcacc
tccatctcctnccttgctcttctc
page-top