Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8478  (registered. 2002)
Contig Information
Length 704 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_h Spike at heading date 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_031200 [Oryza sativa (japonica cultivar-group)]
Score 296
Evalue 3.5536e-25
Total Hit Count 12
Registered year 2002
Contig Sequence     [ Download ]
>Contig8478
tataacAAAGCAGTatgcaTCTACAAAGTTTTACATGTATGCGACAGGTGGAACAGCCTAACAATGTCACCCGCTgccactCACCTTGTTAAATTAAATC
AacAGATAACAAACACTCTTAACTTTCTATATACCATAAAAGTTCTCTACGTCCTGCCAATGCTAAC******ACTTTT*AAGTTACTTTTACACATCAG
AAAAACAACAGGAAAATTGCACACTCAACAGCTGCTGACCATCGGTTGAACGTTCATACGGAGTACATCTCTTCTGACAGTTCTCCTCAAGGTGGAAGTT
CCAAGGTCACGGCTTGCGTGGCAGCTTCAAATGCCAGCGACAACCTAACCGCGAGTTTGCATCCATTCTGGGGCCAAAGGTTAGAAGTTATGCCCTGTTG
GAGAATTAGTCGCGCTTGTGCTCGCCATTGCGTTTTCAGGTTGAAGTCCCTGCCTGATGGTGTTCCAGATTCCTAAGGACAATTCTGGCGAACACTTTGG
CCTCAATGGAAGCTGATGTTGCTGCCGCCGCTGCACGCAAGACCCGAGCCGCTCCAACATTTTGCAGAAGGTCCGCATGGTGTGTTGCATGTCGACCTCC
CGGGATTGAGAACTGAAGAAGGGCAAATGCAGCACACGCacgaagaactggcgtaggattccgaagcatggcaataaatctacctatctcagcaccactg
catc
page-top