Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4522  (registered. 2012)
Contig Information
Length 767 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XN Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226506434|ref|NP_001150399.1|| LOC100284029 [Zea mays]
Score 397
Evalue 5.00E-109
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4522
TTCCCCTTCCCCTTTCCCTGTCTCCGCTCTGCTCCACTCCACAGTCCACCACACCCGCCCAGCCGCAGCCGGAAAAGAGCACGGCGAGATGAGCTCCGGG
ACGGGGAAGGTGGTGTGCGTCACCGGCGCCTCGGGCTACATCGCCTCCTGGCTCGTCAAGTTCCTCCTCCAGCGCGGCTACACCGTCCGCGCCACCGTCA
GGGACACCGCCGACCCAAAGAAAACATTGCACCTGCAGGCCCTGGATGGAGCCAAGGACAGGCTGCACTTGTTCAAAGCAAGCTTGTTGGAAGAAGGCTC
TTTCGATGATGCCGTTGCCGGCTGCGATTGTGTCTTCCACACGGCCTCTCCCTTTTATCACAATGTCAAGGATCCCAAGGCTGAGTTACTTGACCCAGCA
GTCAATGGAACGCTCAATGTTCTCCGTTCTTGCAAGAAGGCCTCTATCAAGAGAGTGATCGTAACGTCATCCATGGCTGCTGTTGCCTACAATGGGAAAC
CAAGAACTCCTGATGTAGTAGTTGACGAGACATGGTTTTCAAGTGCAGAGGTCTGCGAAAAGAATAAGCAATGGTATGTGCTATCCAAGACCCTTGCCGA
GGAGGCTGCATGGAAGTACGCAGATGATAATGGATTAGAAATAATTACAATAAACCCAACAATGGTCATCGGTCCCCTGTTGCAGCCTACACTGAACACT
AGTACAGAAGCAATATTGAAGTTTATAAATGGATCATCTTCTACATACGCCAATTTCTGCTTTGGAT
page-top