Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4519  (registered. 2012)
Contig Information
Length 807 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_EMI Dormant seed with water absorption after breaking 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115443987|ref|NP_001045773.1|| Os02g0128800 [Oryza sativa (japonica cultivar-group)]
Score 342
Evalue 2.00E-92
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4519
TTTTTTTTTTGACAAATTGCAAGAAATTTCACAACATAAGAAGAAGTACGTTCTTGGGAACCCTTTCCCTTCCAGCAAGCATTTGTACACCAAGTAGCAG
CAAAAGTAGCAGACAGTCTCCCAGCAAGGCAACAAAACAATGGAATCACGGAGAGAACAAACGACCGAAGAGGCATGCATGTGCACAGACAGACAGGCTG
GAGCCGCGATTGCCGATCTGGTACTCTTTGCTGCAGCGGCGCGCTCCGGAGGACAGGCAGGCCGCGTGCCCCCAGCAGGAGCCATGGCTCGTCGTCGTCG
GTCACTGCTCCTTCCAGATGCGGCCGGTCACGCGCAGCTTGAGCTCCTGCCGGGTGCCGCTGGAGAAGAAGAGGGCCATGTTGCGGTGGATGATGAGCCC
GTCAAAGCTGTCCCGCACCTTCTTGTGCCCGTCCCGGATGCTCCGCGGCGTGCCCTGCCACGTCAGCTTCCGCCCGTTCCCGCCCACCTCCAGGCTGTAG
CAGAAGCCCCGAGCCTCGCTCTCCTCCCCCATGAACCGCAGGAATGCCATGTACACCGGGGACATCCCCAGCAGGAACGCCTCGAAGTGGAGGCAGAAGT
GCTGACCAAAACACTTGAACACAGTGAGCATCCATGTCGCGTTTTCCACTTCGTAAGGGTTGGACTTCACGTAGCGGTGGTTAAAGGTGCAGCCTTCGTG
CAAGTCCACCTTGTGGTCATTGATGAGATGAGACACCAGCATCGGNNCGTCACCTGCAATCAGGCACTCTGAACCTGCGTATGGACAGCTGTATGGCCTG
AACCTGC
page-top