Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4518  (registered. 2012)
Contig Information
Length 1515 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_r Root 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218187087|gb|EEC69514.1|| hypothetical protein OsI_38753 [Oryza sativa Indica Group]
Score 752
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4518
AAGTTGATGCTATAATAGTCTTCTACTCATTCAGAGATTACACATACGGTGCTCCCTTAGATCAGGAGGCTACAGATAGATACACATTAGCCTATTTTCA
TACTTCATCAGTAGGCATCATATAGGGGCCTCATACTTCATCACTGGCCATCATATAGTGGCATCATACCGTGCATAAGTAGACATCTCATACTAGCACT
GATGCTTAAATTATCGATATAATTTACTTCCAGTAGCTATGAGCGATGCAGCATTATTGCTTCACTTTGGTGTTGAGCCTTCACCCAGCTTGGATGGCCG
GGCCTCACCCATCCGTGGACTGTCTCGCCCCCCTAGAGGGCTGCGTTCATGCCTCAGCTCGTTGACGCGAGGGCTGTAGGCCTTCTCAGACATACAAGGG
CTGCGGATGCCTTTCAGTTCCGTGACAGGAGTGCCACCTGAACTGGTGATCTTCGGACTATTCAGGCGCTTGATCTCACCGCGGCTTCTTGTGACCATGT
CGTCAAGGATCTCTGCGCTTTGGGTGCGTCCCAGTGCCACATCAATATCTTGCGCAGCAAGGTTGAACGGTATAGCCGGTGACTCCTCATACTCCGCTGC
GTCCAGGTCATTGAGATGTGCACCTTTGAAGAGCTTTGGGAGGATGTACTGCCTGACTGGAACCAGGAGCATGATCATGAGGGGGAAGAGAACCCCAGCT
ATTGGGATCCATGTGATCCCAAAGCAAACAAGCAGATATGTGGTCTGGAAGAGTGTGAACATGGCTATCGTCTTGAATGGCACAGTCTCGACAAATGTTG
TATGGTACTCTTCCAGCACCTTGTATCTTCTGCTGGGAGCAGTGAAGAGCAGCAAAATTCGTTCCCAGAACTGGTTACCAGGCAAGCTCTCAATCGCCAT
GAACGCAAAATACCCCCACAGAACTGCTGTAGGGATCTTCTTCAGTAAGGGCATGGCGGCCACGCAGCCCCCAACCATCACAGCCTGTAGAAAGTTGCTC
AACCTTTGCTCCTTGACCTCCATAGGCAGCAGATCATCAATCTCTTTTTCTATGTCAAAGATTGTCTCATCAACCGGTGCATCGAAGTTACCCATGCTTG
ATGCTAACTGGACAGTGGAGTCCTTGAGCTCGTTTAAGCCTTTGACGGACTGTTGTTGGTGGATCAGCGGTGTCTGAATCTGATGATAAGCATCCTGCAT
GTTGTTGTACAGTTGGCTCAAGCTCGCGTTCTGGCGCATGCTTTGCCGTGCCGTGGCCACTAGTCGATTACGGAGTATCTGATGCTTTAGAGTAGCCAAG
CTCTTTGTATGCATCGGCGACTGTGGAATGACGCCATTGGATGGAGGGATACCAATTAGGCCACACATCAGTGTCAGGAAGCCTAGGAGAAGCAAATCAT
AGTGGAAAGATGGAGGCTTCCTCAAATTAAATTCCGCCTGCTGAGCGAGCTGGGATGCCACGCTNNNNTCGAAGTAATACAGGACAGCAATCATTGTTGC
AGGCATGAAGGCACC
page-top