Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7819  (registered. 2002)
Contig Information
Length 799 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11414 [Oryza sativa Indica Group]
Score 738
Evalue 2.64791e-76
Total Hit Count 305
Registered year 2002
Contig Sequence     [ Download ]
>Contig7819
gcAGGAATGGGTGACTCTTTGAACAGCAATACATCGGAAGAAAAAACCTCAGATTGTGCATCTCAAAGCAAATCTAACAATATGGCTTCTGATGCAGAGA
AGAATGAAGCTGAATTACAGGCTGAGACAGATGCAGCGCCAAACAGTGTAGTTGCACCTGAGGCAGGAAGTTACGATGCTGATGGCCATGGCATCACAGT
GTCGGAAATGGAAAATGTGGTCTCATCCCACACTAACATTTCTGCTGAACAAACACATTCTGGGCAGGAGTCAAACAGTGATAGGGCAGTGGCCTCTGCT
GAGTGGAATCGCCAGAAGGAAGCCGAACTTAATCAGATGTTAATGAAAATGATGGAGGTCATGCCTGGGAAGTTTGCAGGCGCCAATGTAACTGCTACCG
GGCTCATTTCTGCAAGTGAGAAGAAAGGTGGACTTCAAAGAGAGAAGCGAGACACGAAGGTTCGAACAGAGAAAGGTGTAAAGCGACCAGCAAAGGAGAC
GAGTACCAAGCTCTTGAGGGAATCCGTTGGGCAGAACAGAGCAGCAGTTACCCCCAAGACTAGCATCACAACAGAGAAGCGTAATTCACCTATTCCACAA
AGGGCAAGGAGAAATTCATCACCTCCAGTCTTgccaaaggaagtgatctcaaagacaccagcaaaaaaaagttcccccaaaccatcacctgcaccagcta
cccgtagttcatggtcaggatctttgactaaagcaactagtagtactgcacagaaaactaaaaactctcctggagcagtttcaacatcgacaccaacta
page-top