Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4493  (registered. 2012)
Contig Information
Length 1084 bp
Clones alternative view 122 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 12
Wh_dL Crown of seedling 13
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 7
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 4
WH_XB Root 10
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|464639|sp|P35266.1|RL171_HORVU|RL171_HORVU RecName: Full=60S ribosomal protein L17-1
Score 338
Evalue 7.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4493
GGGCGCTTAAAATCTTGGATGTGGGCGATTCTTTACAAGGAATTTATGTGTTTCATCAACTAAGTTACATACTGATGCGGGACAGCATAACGTAGGGATC
AAACAGTAATAGCAAAGGAAAACTCATGCGATGAAAAATATTCCAAAACACAACCAGATTGAATCCAGTACATGAGACATCATCAAAGGTTTCACAAAGT
ATGAGCTAGCAGTATTTAGACGACAGATAACAGGCCAAAATTTCCACTCAGCCAAACCAGATGCTACAAGCTGCTCTAACGAATAGGGGGATAGGTTATG
TAGAGCTTCCTTCTCTAGGCCTTCCTGGCGATCTGGGACTCAGCCTCCTTCTTCACCGGCTCTTCCTTCTCCGACAAGATCAGCTCGATGTGGCAAGGGT
TGGACATGTAGGGGTTGATGCGTCCATGGGCACGGTAGGTCCGGCGCCGCTGCTTCTGGGCCTGGTTCACTTGGATGTGTGAAATGTAGAGAGCATCGAC
ATCAAGACCTTTCACCTCAGCATTGCTCTCTGCGTTCTTAAGAAGATCCAGAACGAACTTAGCAGACTTGGCAGGCCAGCGTCCCTGACCATTTGGCTGG
CGGTTCTTAACCTGGGCTGTACGCCCAACACCACGGCAGTACCTCCGGAAGGGGATAGCTTGCTTGTGTGCCAACACATCCTCAAGGTACCTCTTGGCTT
TGTTCAATGACATCTTCCTCAGGGCAAACGCTGTTTCCCTCGTGTTCTTGAAATGCACACGCAGGTCCCGGCCCATGGCCTTGGCGGACTTGGTGGGATT
GGCGGGATCCGTTGAGTACTTCACCATGGCTGCGGCGGCGCGGTAGACAAGGCAGCGGCGGCTCGTGCCGAATTCGGCACGAGGTGCACTTGAAACGGAG
CGCTGTGTAGCAAGTGTATACCTAAACGGAATGTGTGTTGCTGTTGCTGCCTCTGGCATGATCCTGCTGAGGCGATTGTACACCCTTGGACCTAGGTTTG
GTGTTGGGTGGGCCATTGGCGGCGCAAGCCTTCGTCCCCGCCCGTGCTGTTTGTCACGCATGTACGGGCAGATATCTTGCATTT
page-top