Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7787  (registered. 2002)
Contig Information
Length 588 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_f Spike at flowering date 1
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_004864 [Oryza sativa (japonica cultivar-group)]
Score 99
Evalue 0.0168371
Total Hit Count 6
Registered year 2002
Contig Sequence     [ Download ]
>Contig7787
gggcataaaaagcgttcattcatcagctGTAACGTCTTCTCCGCCAAATATATAAACACGGAACTGCCGCATCATCTCGGTAAAACCCTCAAGCATCCAC
AGACCATCAGCCACCGCAAAGTTCACTACCGCTACTTACTACCAACACATAATAAAAAGCCAGGCATGACATCCCCCATCCAACAAGCGTATCGTCTCTG
CGCGCTAGTATCGCCAACCGACAACACACGCATGTCTCTCGATGCCAAAAAGACACTGCCAACACTTAACCAGAGTTTTTTTTGTCCTGCTGATCGCAAA
AACCGTCGGTCACGAGGGCCCATGGGGCGATCACCGGTTCCCGTTCATCTTGGCCATCATCTTGGCTATGATGGGCCCCACCTTGGGGTTCGCCTGGTGC
TTGGCGGCGGCGGCGGCGGGGAGGGTGGCGCCGAGGGAGGCGAGGTAGTCGCGGAAGAAGGCGAGGGCGGGGTCGGCGAGGAGCGCCGGGTCCTTCTTGC
ACGCCTCCACGAAGGAGCGCAGCTCGCCCAGCTTGGACGGATCCATGGCCGGCCTGGagct*ctAGGGTTTGGGTGGAGGGTTGTAgc
page-top