Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4485  (registered. 2012)
Contig Information
Length 817 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|116310721|emb|CAH67518.1|| OSIGBa0092E01.13 [Oryza sativa (indica cultivar-group)]
Score 306
Evalue 2.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4485
TTTTTTTTTTNTAAAGACCGAGCCAACAAATTTTAAAATTGACAAAGTCACCACATCAAGAGGCTAAATTTAGTTACACATCAATCTGGGAGGGGATTAA
AACCAGAAGCGTGAGATCTGAAATCGAACACATGTACACGTACGACCCCTTTGTTACTTCCGGTCGCGCACGTACGTCAGTGGATTGGATTCGATCGGTC
GGCAGTGGCGGGATCGATCGATGGTTAATTGCGCATGGTGATGGCGGTGGAGGAGGTGAGCATGTGCGTCACGGTGGTGACCCACCTCTTGTACACGGCG
TAGTCGTCGGCGCGGAGCTCCACCTTGCCCCTGCTCGTCCTCACCTCCACCGGGTACGTCGCGTCCTCCTCCCGGCTCGCCTTCTCCGGCGCGCACGGCC
GGACGTCCTCCACCACGCATTCTTTGGCGTTGGAGAAGGCCTGCATGACCAAGTTCATCTTCTTGATCCGGAGGACGACCTTGCCGTTCCTGTCCGTGGC
GGCGGACACCGTGTGCAGCTTCCACTTCCCGTCCGGCATAGCGACGAACAACTCGTCGCCCTTGGCCAGCGCCGCCTTGGACCTCGCGTAGTTGAAGTCG
AAGTCCAGGTCGTCCTGCCACGGCGCCGTGCCACCCTGGTCCGCCCTCTCGCCCTGCCCATGCCCGCCGCTGCCCCCGCGCCTTCCTCGCAGCGCCGCCG
CGCCGCGCNNNGAGGTGGCGGCGGCGGCGGTGAGCGTGATCACGTTGCTGGCGTCCGTGGCTGCCACGGCGGCGTTGACGGCCGCGGCGACCTGGTCCCG
CGTGGCGCCCGCGGCCT
page-top