Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7676  (registered. 2002)
Contig Information
Length 753 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Leishmania infantum] >gi|134073491|emb|CAM72222.1| hypothetical protein, conserved [Leishmania infantum]
Score 80
Evalue 4.64666
Total Hit Count 3
Registered year 2002
Contig Sequence     [ Download ]
>Contig7676
gggaagacctcctccgtccccgctcaagtctcctccgtccaccgctcctgcctcctccgtccggcgactgcgacacccctgccctcctcccttcgacgct
ctgcccctccagatggggcgacgggaccggggtcgccatcctactacttcccagatctcgtctccacccccaagatcttcaccttccgatgatgacgacg
gccaggagatcatgctcctcttcgtccaagatccaagagcctcctctcctgtttgagtTTTGTATCACAAGAACCAATACCGAAGAACATCCATCGTTTG
CAGTAGTGTTTCTACCTGACTATCCTGACCTCACAACAAAGCCAATTGATAGTATTATCGATGCAGTGCTATTAAGTCATCAATTACTAATGTACTGTTA
GAAAACGGCCTTTACTGATTGAAGGAGAAAATTGCTACCAAGGAGAAAACATAAGGTTTCCTAAAGCTAGCCAATGAAAATGTTCAAAGAAGTTGATCTT
GAAAGTTTCAGTAGTGACTATCCCAGCAGCAACACATTTTGGCATGGATGATTTACACAGATACATGTTGATAATGGAACTAAATGATTATTCTTGCTGG
ATTTCTACCTTAGTTAGCATTTCCTCTGTTAAACcatgatTAGCACGCTAAATTTATTCGCAgtgccaTTATTTGTGCGactgaacATGtataacttatg
tCAGcatgtttgatgtggattgaagtgtttttttttacagattaaaaaaaaaa
page-top