Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4481  (registered. 2012)
Contig Information
Length 1690 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115468796|ref|NP_001057997.1|| Os06g0598900 [Oryza sativa (japonica cultivar-group)]
Score 637
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4481
AATTCGGCACGAGGCCTAGTGCCCCTAGGCCGGCCTCCGGGCTCGAACCCACTGCTCTAACAAATAATAAATCCGCGTACAAATCTACCCCCACTGACCC
AGATCATCCTCGTCCCCATCCGCCCCCGCCGCCGATCCGCGCCACAATTCACATCTGACTTCCCCCAATTTATCTTGCTTCGATTCGATTCTCTTGGTTC
GTTCGTAGGGGCTAGGGTTGGGAGCCGATCGCGCGCCGCCGGAGCCGGTCGATAGGGTTAGGGTTAGAGTGGGGAGGGGCTGAGATGGAGAAGAAGAAGG
CGGCGGTGCCGCTGGTCTGCCACGGCCACTCGCGGCCGGTCGTCGACCTGTTCTACAGCCCCGTCACGCCCGACGGCTACTTCCTCATCAGCGCCAGCAA
GGACTCAAATCCAATGCTTCGTAATGGTGAGACTGGAGATTGGATTGGGACTTTTGAAGGTCATAAAGGTGCTGTTTGGAGCTGTTGCCTTGACACAAAT
GCTCTGCGTGCTGCCTCTGGTTCAGCAGACTTTTCAGCTAAAGTATGGGATGCACTAACAGGTGATGAACTACATTCATTTGAACACAAGCATATAGTCC
GTGCATGTGCCTTTTCTAAGGATACCCACCTGTTGCTTACTGGAGGTATGGAAAAGATTTTGCGTGTATATGATTTGAACAAACCAGATGTTGCTCCGAA
AGAACTTGACAAATCACCTGGTTCTGTCCGAACTGTTGCTTGGCTTCATAATGACCAAACTATACTGAGTTCCTGCACTGATACGGGTGGAGTAAGGTTA
TGGGATGTGAGGAGTGAAAAAATTGTCCAAACTCTTGAAACCAAGGGACCTGTTACCAGTGCAGAAGTAAGCCAGGATGGCAGGTTCATCACCACAGCTG
ATGGCTCAAGTGTAAAATTTTGGGATGCTAATCACTTTGGGCTTGTTAAAAGCTATGATATGTCGTTTATTGTGGAGTCGGCTTCACTTGAACCAAAGTC
TGGCAGCAAATTCATTGCTGGAGGAGAAGATATGTGGGTTCATGTATTTGATTTCCTTACTGGTGAAGAAATAACTTGTAACAAAGGGCATCATGGTCCA
GTTCACTGCGTCCGGTTTGCACCTGGTGGTGAATCATACGCCTCAGGGTCGGAAGATGGTACTATTCGGATCTGGCAGCTGAGCCCACCTAACGCGGATG
CTGAGGAGGCGATCGATACAAATGGTAAGCCCAAGGCTGGAGCAGAGGAGATTGCGTGTAAGATTGAAGGCTTCCACATTGCCAAGGAGGAGAAGGCCGG
GGAGTAGGATTACATCGTTGGATGAGATGCTGTTGTTATCCTCAAAGCTGCTCTTTCCGTCTTGCCTTGCGTCTGTTCGTCAAAGCCGGTGTCCGACGCA
AGTGTGGCTGGCTTGTATGAGTAGTTAACTGCGCCGTGGGAAAAATCTTGCCCTTCATCGAGCAAATGCTGGGGATTTTTTGGTACACCGAAAATAAGCC
AAGAGTAGAACATTTTGTGGATGAGGTGTTGATCAGGATTAGATTGAGATGCCATTGTGTATTTTGTGTTGACACATTTTTGTCCCACCCTTTTGTGTTG
ACTATGATAGACGAAATGGTGTTGTTTTGGTTGATATTCGCTGGAGAACATGGCAGAAAAACAAAAAGACATTTCCAGCGCCACTGCCTC
page-top