Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7625  (registered. 2002)
Contig Information
Length 638 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00313 [Oryza sativa Indica Group]
Score 88
Evalue 0.391543
Total Hit Count 16
Registered year 2002
Contig Sequence     [ Download ]
>Contig7625
agggtgttgATGATATTTAACTCGGGatcaagtTTCTACAAGGCAAGCTAAATAATAAACACATATCTGACATTTCAACCTCGGTACCATCCATGAGTTT
TAAATATACAGAGGGGCTACACAAATGATGAGTTCTCGATTCGGAAGTTTTTACTGAGCTTTTTAGACAACTATATATTTATTCAAAAATTAAGACAAGC
AATTGGAACTGTAATCCAACACTTCATTCACAGGCCTTCCTTCCACCCCCAGCTTGCTGCAACATCGGCAAATGGACTCTCCAGGACCAAATCAGAAACT
CCCCCTCAGGCTCGGCAACACAGGGACGAACATAGTACCGGTTTGATCTTATTTTGGACCCCCACCCCTAATCACAAGTCCAGATGCATGCTTGATTTGA
TCCCGAATGCACAGCTGACCAATCACAATATCCAATGTTTGCCATCGACTTGCGCAACTTGTAATAACAATAATGATAAGTAACAGCAGGATTACCTCTA
GGATACGCAGCATAACAGAATTCACCAATCCTTCGCTATGAaccaccacggttctgattcatgtcagcctgaccgccggcatcaggtgctcccatgggct
gctgatactgaggtggcaatgatgctggtggtgctccc
page-top