Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7454  (registered. 2002)
Contig Information
Length 922 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34047 [Oryza sativa Indica Group]
Score 749
Evalue 1.7956e-77
Total Hit Count 466
Registered year 2002
Contig Sequence     [ Download ]
>Contig7454
ggggcgtcggaggcgaagcgacgagcagacgatgattgtgacggcggggcgggcgggcgcctgagttgttcaccacctaccctcccccgtctctcgaaga
ctttccacccaactgatcacaccaacagcaacagctaggcacagcccacgaacaaactgccgttgagaaggcgaaccatttcttcctccccggagacacg
cggagaaactcgacgactcctctccctccccactttagtcccgAACTCCCGATCGGGAAATCTCAGCGGAGGCGCAGCATCTCCCTGGGCGGAGGATCTC
GGGGCCCGGCGGAGAAGGTGGACCGGCATCACGCCAACTAATCGAGCCAGAGCCGAGAGGGACAGGACAGGGAGGAAGCGGTTCAGAAGACGAAGAGGAG
ATGTCGTCCGACGGCGGGGGCTCCCAGATGGGCGTCGCCGGCGCGCTGGGCCTCTCGGTCACGTCGTCAGTAGCCATTGTTATTTGCAACAAGTACCTCA
TGAGCACCCTTGAGTTCTACTTCGCGACGACACTGACGAGCTGGCACTTGCTGGTGACCTTCTGCACGCTTCACATAGCGCAGCGCCTGCGCTTCTTCGA
GCCGAAGCCAATCGACGCGCAGACTGTCATCTCCTTTGGGTTTCTCAATGGAATCTCCATTGGCCTCCTCAACCTTTGCCTTGGCTTCAACTCAGTTGGC
TTCTACCAGATGACCAAGCTGGCTATTATACCCTTCACCATGCTCTTGGAGACCATCTTTTTGAGCAAGAAGTTCAGCCAGAGCATCAAGGCCTCTCTCA
TGGTCCTCCTCCTGGGAGTTGGCATCGCATCGGTCACTGATCTCCAGCTCAATCTCCTCGgctcaatcatcgcagtgctcaccatcgctgcgacctgtgt
ctgccagatcctgaccaaccaa
page-top