Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7427  (registered. 2002)
Contig Information
Length 887 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ABC transporter [Oryza sativa Japonica Group]
Score 1114
Evalue 7.87254e-120
Total Hit Count 494
Registered year 2002
Contig Sequence     [ Download ]
>Contig7427
gcagaagaacagctcaatttttcctggatagctttgaagagcgtctagctgcacaaaggaaagagagagagatggcaaccgtggaacctGGATTTAAAAA
ACAATTATCTAAGGAGGAAAAGTTTGAAAAGAAGAAGCAGAGACTTGCAGCTATCGGAGAGGATCTTTTGGCAATTGCTGCTGATCAACCATTTCGGTTT
CCTGCCACCTTTA*CATTTGTGGTCAGAGCATTCTCAGTACTGGATGGTATTGGGAAAGGTTTAGATCCTAGATTTGATATTACAGAGATTGCTAAGCCT
TATGCCATGGAGTTGCTCAGATTTAATGAAGCTGGTGTTGAAGTACTTGTTAAGGATGCAAGGAAGCGGTGGGACAGGCAGTCTCGTGCATTCTACAATG
TGTTCCGTCAACCTGACAGAGTCGAAAAACTTGCACAGATCATTGAGCGTTTGGAGCAAGGTGATCTCAAGCTTCGTGTCAGAGCATTAGAAtcggaAAG
ATCGTTTCAAAGAGTTgctgcTGTACAGAAAACAATTGGATATGGAGTGGCTgcgggcagTTTGGTAAACCTCGCTACCATTCTGCACCTCAATtctatC
CGGATGCCAGCAACCATCGGATACTGTCTTTGTGCGTTCTTtggactacaaatcctgcttggcgttctcaaggtgaagaagctggaccaacaagagagat
tgataaccggcactgcctgagttcaccatcgaccagtgagagctgacccaaaagatttcagtgtaatacgttgcggttatcatccgctttttcttttcct
tttgcctgtgtgcagttttacctcagaggtggtgtagcatagccatcggcgtacgagtatgaaatctttgtacatgcggtgtaatag
page-top