Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7390  (registered. 2002)
Contig Information
Length 605 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_f Spike at flowering date 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11578 [Oryza sativa Indica Group]
Score 466
Evalue 5.09838e-45
Total Hit Count 114
Registered year 2002
Contig Sequence     [ Download ]
>Contig7390
aggtctccctcctcctcccctgtttttctttctttctttctttctttctttttcgcggggatcctcctcccctgcccttccccccatccctctcagatcc
agctccaggagtgacaggagcgcgacgagtgcggcggccgaactcgcgggatctccccggcgctgcgcaccccgtgtcctctcctctcccacgggccacc
taggtttcagccttgccgccgccgatcaggacacccaaGGCCCCAAGATCTGAGGAGATCCGCTTCCTTTTGGTTTATTTGTGAGGCAGTACACCTGAAG
AAATGTCAGGAGGTCGGCAGACATATTGGTGCTTCCAGTGTAGACAGCGGGTTAGGCCGCGTGGACGGGAGATGGAGTGTCCTTACTGTGATGCTGGCTT
TGTGGCTGAAATGGATGATGTCGATGCTCTCATGAGCCAATTTGTTGGGATGTATAGTGATTTTCATCGTGACCCAAGgttcgggaTCATGgaggcAATG
TCTACCGTGATGCGACATGGAATGGGGAGCATGAATCGAGAGGCTGATGTAAGAGGAAGGCCAAGCATATTATCTgaactGGAGATGGAatttggttcgg
ggcca
page-top