Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4449  (registered. 2012)
Contig Information
Length 855 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218191195|gb|EEC73622.1|| hypothetical protein OsI_08122 [Oryza sativa Indica Group]
Score 332
Evalue 2.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4449
CTTATACAGCAGTTTATAAACAGAATCACTTATACAGCAGTTTATAAACTGAACGACAAGATCACCACATATCTGCATCCTCTGCGTTCTCTTCAGTTAC
ATCAATTGGTAAAATGGCCGGCTTGGCTGACAAGGTGACTTTCAAAAGTTAATTTTGATCCCATGCATACATTCAATTCATCTTGTATGTAGCTATGGAT
CATGAACACCCAAACATTTTGACTTATTATTCGTCTATAATTTCCTGAAGATCAGTATGCAAAACAGTGTATCCTTGGCCACAATAAAATTCGAGAAAAT
AGCAGCACTTCATATTTGTGATGATTGTCGGTGTGTATTGCATTAAGAAGCCTTCATATCATCGAGCCCAACACTGGCCAGGAAGTCATGATTCTCCTTG
AGAAAGGGATAAAAGGTGGTGCAGAATTTCTCAATGTCTGCTTTGATATCACCCGTTCCGCTAATTACCTCCATAAATTTATCTTTGTTAGGAGCAAGCT
TCATAGCCACCGTAAAACTGGAACTGGCGAGCCACCCATGCCATTTCTTCAGAGTTTTTGTGTATGAATCAGTACATGCTTGACTCATAGTCCAGTCTGG
ATGGTCAAGTAGATTACGGAACAGTTCAACAAGGAAGTCCATAGCCCTCGTGAGCCATAGAAGTCCATTTGTGCAGCTTGATGAACCCTTTGCGGTCTTC
TTTTCAACTTCTTCTTGGACCATGGTGTACAAGTGCTCATATTTTGACGGGTCTGAAGAATACTTGTTCTCCAACCTCGTGATATTACCTCCAATATCAC
TCTTCACAATTGCCATAGCAGCACCAAATTTATCCAGGACAGGCAAGATTTGCTT
page-top