Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7290  (registered. 2002)
Contig Information
Length 915 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0949200 [Oryza sativa (japonica cultivar-group)] >gi|113534928|dbj|BAF07311.1| Os01g0949200 [Oryza sativa (japonica cultivar-group)]
Score 558
Evalue 2.4793e-55
Total Hit Count 51
Registered year 2002
Contig Sequence     [ Download ]
>Contig7290
tgcaggcaattcggcacgaggtggagtattgctgaggccgaaaagaagTTGAACAAACGAAACCTATctctaAATATCCAGCACGCACATTTGCAGATTA
TAAAGCCAAACAGGACAAGTACAGAACACTCTGGAATGATGTTCTTGCCAATCCACTTAATTGGACTGATAACCGGGCTGACAAGGCGAATGGATCTAAA
AATCCAAAATATCCTGATTTCAAGAACAAGACAGCAGATGAGGCACTCTGGCTTGACTCAGCACCACATTATGTTCTAGAGAAGTTGGATGGTTTGACCT
TTAATAGTGGCTACAATGCGGCTAAAACATATAAGCCTTTTAATTCTAGCATGGGGAAAGGTACAAATACAGGTTGGAGTAAATTCAAGACAAGCCAAGC
tgcctctcctgagaaacagaaaaaggaagcggaattgtggcagaatcttgtggacagtcctcaaagctggtgggacaaccgagcagacaagagGTCACCT
AAAGCCCCTGACTTCAAgcacaAGGACACCGgcgaggctctgTGGTTGAGCCCCAAGACACCAAGTTCGGTTACAGATGCGCTGCCACCGGTGAAAGGAG
GCAGcagaggatttagaaggccggagaccctgctctcttgacctatctnaggtggccttggttgtgcnatgtgcgttgcctcagctctattcttttgcta
aatactcagtctgtctcggtctgctaacttatgcgagtctcggtctgctaacttatgcgagtctggtagagaccacttcaagataaaaaaaaagaatctc
tgccttaacctccagcgctgtcactgatggccatgtgggttgggttgggttgggccttcgtaatgctatgccaggatgtaaatagcatttccacaaagtt
nannatatttatgcc
page-top