Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4442  (registered. 2012)
Contig Information
Length 650 bp
Clones alternative view 83 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 6
Wh_r Root 2
Wh_yd Spikelet at late flowering 3
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 1
WH_XA Root 12
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 12
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115457956|ref|NP_001052578.1|| Os04g0376000 [Oryza sativa (japonica cultivar-group)]
Score 220
Evalue 1.00E-55
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4442
TTTTTTTTTTAACAGGAAACTAACAACATACAATAATTTTTTTTTTGCAACACAAACAAGCAGCTGTAGATCATAGTGTCAATAAGCATAAGTTCGAATT
TCATGCAGGATATCGAATACATAGTACTTAGATAGCAGCGGTGTCCACACAGAACATAAAATTCATGCAACTTCTGAGCAAAACTCGGCCGGTAAAACAT
GTGCTCCTAACCTAGGCCTTGATAGCATACTTCCTCATGGGGAAGTACTTCTCGCGCTTCTTCTCCCTCTCCGTCTTCAAAGAGAGCTGGTGCTTGGTGA
GACGCCTGCGGATGGCGCGGGTCTTCTTGGGGCGGAGGTCGAGCGGGAGACGCTTGTTCTTGTACGCCTCCCTCAGCGCCGACTTCTGCTTCTGCGAGAT
CACCGTGAGCACCCTCGCAATCGAGGTGCGCACCACCTTGATCTTGGAGAGCTTGTTGGGGGCGCCGCCGGTGACCTTGGCGACGCGGAGGAGGGAGAGC
TCCGCCTTGAGGTCCTTGAGCTGGCCCTGCAGCTCCGCCTTGTTCTTCCCCCTCAGCTCGTGCACCTTGATCCGGGCCATTGCTGCTGGCGAGCTGGTCT
AGCGGCGGGAGCGGCGGCGGCGGCGGGCGAGGGGATGAAAATCCTCGTGC
page-top