Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4435  (registered. 2012)
Contig Information
Length 912 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 1
Wh_PCDAM Anther at meiosis 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14571547|gb|AAK64576.1|| serine/threonine protein kinase [Triticum aestivum]
Score 395
Evalue 4.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4435
CGCTATTTTTGGCCTAAAAGCGCCCTTGGGCTAACCCTCCTCTCTCTCTCNNNNNACAACAGCTGACCCTGTCCCCTGCGGCCCTCATCCCGACGCCGCG
GCTCCGGGGGCTCCCGATCGAGGCCCGGATCGCTGGAATCCGTGCGGCGCCGAGGTCGCGTGGGGTGCGAATTGGAAGCAGCGAGCTGTACTTCCGGACC
CGAAAAGCGGGCAGTTCCGGGGCAATCGCCTTTGGGTGGACTGTGTGAGGGAGAAAGGGAAGAGCGGAAAGGTTGCCGGAGCTCAGGCTTTGGTTATCTG
AGAATGATGGAAGCGGGCAAGTTCCCCGGGATAATTGGTGCCGTAAGCGGCCAGGACGGTGGCGTCAACTTCTGCGACATGGCATACTACCAGAAGCTAG
GGGAGGGCTCCACCATGTCCATTGATAGCCTTAACAGCATGCAGACCAGCATGCACGGTGGTTCCATAATGTCTGTGGACAACAGTAGTGTTGGTTCTAC
TGACTCGCGTACTGGGATGCTTAACCATCCTAGCCACAGGGGAGCTGTTGCTGTGGTCAGCTACTCGGTTGGGAACAGCATTTTCCGTCCTGGGCGGGTG
TCTCATGCCTTGAGTGATGATGCGTTGGCACAGGCTTTGATGGACACTAGATTCCCGACTGAGACACTCAAGGATTATGAGGAGTGGACCATTGATTTGG
GGAAGCTCCACATGGGATTGCCCTTTGCACAAGGCGCATTTGGGAAGCTATACAGGGGGACCTACAATGGGATGGATGTTGCCATTAAGCTTTTGGAGAG
GCCCGAGGCTGACCCCGCACAAGCTCAGCTGCTGGAGCAACAGTTTGTGCAAGAAGTTATGATGCTTGCAGNNNNNNNNNATCCAAATATAGTCAAGTTC
GTTGGCGCATGC
page-top