Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7203  (registered. 2002)
Contig Information
Length 542 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_005384 [Oryza sativa (japonica cultivar-group)]
Score 152
Evalue 9.61091e-09
Total Hit Count 53
Registered year 2002
Contig Sequence     [ Download ]
>Contig7203
gtGAATACACATCCCAGCAGTCAGTAACCTTCGCTAGGTCTCTCAGCACTCCCCGAACAACCCC*GCGAAGTCAGGATGAGGCCGTTCTACACGATGCTC
CTAGCCCTCGCCCTTGTGGTGCTATGTTCAGATGTGGCGACGAAGGTGGTGACTGCGAACGGCGATGGCGCCACTGCGACGGTGACCCCATGGACTGCAA
GGTGCTCCCGACCATCCCGGGAATATGCACTCCCAAGAAGTGCATGGAGGACTGCCAGGGCGGCATCGGCCGTTCCTCGGTGGGCGAGTGCGTCTCCGAC
GGATGCCAGTGCACGTACTGCACTATCCCGCCTAGGGGTCGCCGGAACTGAACGGAGAACAGGCTGACGCTGCTGCATCCTTCTTTTTCCTGATGAATAA
TGATATGTTGACGACGATGTTTTGGTCGAGATAGGATATTGACCTCCTTCACTGTTACTCTCAAATAATATTCCTGTTTTGTACATGTGTTAAAACTAGA
GTTTTGTTCAACAGAAATCCTATTTTTATCTcaaaaaaaaaa
page-top