Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7198  (registered. 2002)
Contig Information
Length 995 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34360 [Oryza sativa Indica Group]
Score 269
Evalue 9.23698e-22
Total Hit Count 383
Registered year 2002
Contig Sequence     [ Download ]
>Contig7198
acgaggtGGTTGCTTCTAAGAAGAGTGTTGTGTTGTCCTGGCATCTGTGAATCACGGCCCTACTAAGGGCCAGTTTGGTTGGTGTCCACGGCCACATGCC
TGGGCAATAGCGTTGCCTGGCATGGACACATTTTCTGTTTGTTTTGCTGCCTGGTCAGGCAACTTTGGATGAGAGGCGTTTGGTTACCACCCTGGCCTGG
ATAGTTCACTATGAATGAAAAATTCAGCTCATGAGCCCATGTACGAAGAACAGTCTCTTTAATTAAAGAATTAAAGGAGCCCAGGCAGCTGCAGTGTTCG
CCAGGCGCTCCAATTCTTACGCCTGGCCCAGGCTAACTATCTCCCTGGCTTCACTGTCCAGGCTAATCACTTGCATGCAAACCCAGGCCGGGCTATACCT
GGCATCTTGAGGACCTGAACCAAACAACTTACAGGCAACCTCCAGGGACGTCCCAGGCCAGGCGAGACTTTCCCAGGACGCAAACCAAACTAGATCTAAA
TTCATGAATGAAAGAAGAGAAATCCTTGAAAAAGGCGAGTACTATTCTGACTAGACATTTTTGCAGGTCGATGCTTGTGCCCATCCGTTCTTCGATGAAC
TGCGGGAtcccaagacctgcttgccaaatggacggccattaccaccattattcaacttctcgggagctgagctagaaggcctccctgttgagctactcca
ccggatcattcctgaacatatgaggaagtgaagagagatggcggctggagaagcggtcgctatttctcggcgccactgtgcgggtggagaccggacaccg
cgagcatatccatggctngtcgtggatttgatctggagtagactccccggctggcctggactggcctggagctagagaagggcaaccgcgggcatgtgcc
cagggcccagacccacccacactgctgtgggcccctgttttaagtgtatgtgtttatgtcgtttgatgaaagaaatagtatgttgcctcgtttcc
page-top