Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7191  (registered. 2002)
Contig Information
Length 660 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 891
Evalue 3.22031e-94
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig7191
gaggaatTCGGCACGaggtCTGGATCCGCCCCTGCGCGCAGCACTCGCCCCCCGCCCCCCGCCCCTGCTCGTCGAGCCCTCGCTCCCCGGATCTCCAGCC
ATGTACGGCGGCGACGAGGTCTCGGCCATCGTCATCGACGTGGGCTCCTACAGCTGCAAGGCCGGCTACGCGGGCGACGACACCCCCAAGTCCGTCTTCC
CCTCGGTTGTTGGTTCAATTGAACAAGCGGAAGATACCGATGAAGCTAAGCCAGAGAAGGAGGCTGACTCTGCATCAGATCCTAAGAATGGATCCAAGCC
TATGGATGTGGACAAAGCGAAGAAAAACCGCAAATTTTATGTAGGTCAAGAATTAGAATTCAGGAGGGATCATATGGAGGTGATCTCACCGATGAAAGAT
GGAACAGTTACGGATTGGGATGTTGTTGACAACATATGGAATCATGCTTTTAGACGGCGGCTATTGATCAATCCTGAAGAGCATCCTATGCTCATAGCGG
AACCATCTATAAACAGTGCACAGCAAAGAGAGAAAGCAGCAGAACTTATGTTTGAGAAGTACAAAGTGCCAGCGCTGTTCCTAGCAAAAAATGCAGTTCT
CACATCTTTTGCATCTGGACGTGCTACATCTCTAGTGGTTGACAGTGGTGGTGGGTctac
page-top