Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4431  (registered. 2012)
Contig Information
Length 1777 bp
Clones alternative view 228 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 20
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_yd Spikelet at late flowering 5
Wh_CSEC Callus 15
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 8
Wh_PCDAM Anther at meiosis 5
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 15
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 9
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_SP 6
WH_XA Root 16
WH_XB Root 17
WH_XC Root, treated at 50 microM Al for 6h 20
WH_XD Root, treated at 50 microM Al for 6h 11
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23℃ 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125597641|gb|EAZ37421.1|| hypothetical protein OsJ_21756 [Oryza sativa Japonica Group]
Score 721
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4431
GCCGCCATAAATCCGCGCCCCCGTCCCCTTNNNNACCCCTCTCTTCCCCACCCTCGCCCGCTGAGGTTTCCGCCGCGATCTCGTCTCGATCCGCACTCTC
TATCTGAGATTTGGAATCGGGTGAAGCCTGCAGCTCCTGCCGACATGGCGCTCGTTTTGCATTCAGGCAGCGGCAACAAGAATGCCTTCAAGGCACTTAT
TGCTGCAGAGTACTGTGGGGTCAAGGTTGAGCTCCCCAAGAACTTCGAGATGGGTGTATCAAACAAAACCCCTGAATTCATCAAGATGAACCCCCTTGGG
AAGGTTCCTGTTCTTGAGACTCCTGATGGTGCTGTTTTTGAGAGCAATGCTATTGCACGCTATGTTGCTCGCTCAAAGGGTGACAACCTGCTTTGGGGTG
GTTCTCTTATTGAATATGCACGTGTTGAGCAATGGATGGACTTTGCTGCCACAGAGGTTGATCCCAATATCGCAAGGTGGTTGTACCCAAGGCTTGGTTA
TAGGGCTTTCAATGCCCAGGATGAGGAATTCGGCATTGCTGGATTAAAGAGGGCCCTTGAAGCATTGAACACACACCTGGCATCAAACACATTCCTTGTT
GGGCATTCTGTCACTCTGGCTGATATTGTCATGACATGCAACCTCTACCATGGTTTTGCTCGGATCTTGACCAAGACTTTCACATCTGAGTTCCCTCATG
TTGAGAGGTACTTCTGGACCATGGTTAACCAGCCTAACTTCAAGAAGGTCATTGGCGAATTCAAGCAGGCAGAGGTTGTACCTCCTGTTCAGAAGAAGGC
TGCTCCTGCTAAACAAAAGGAGGCCAAGAAAGAGGCTCCCAAGGCGGCCCCAAAGCCAGCAGTAGTTGAGGCACCAGAGGAAGAGGCACCAAAGCCTAAG
CCCAAAAATCCCCTTGATCTACTGCCACCAAGCAAGATGGTACTTGATGACTGGAAGAGGCTATACTCAAACACTAAGAGCAACTTCCATGATGTTGCTG
TTAAAGGTTTCTGGGAGATGTATGACCCAGAGGGCTACTCTCTGTGGTTCTGTGACTACAAGTACCAGGAAGAGAACACCGTGTCGTACGTGACCCTGAA
CAAGGTCGGCGGGTTCCTGCAGCGGATGGATCTGTGCCGCAAGTATGCTTTTGGCAAGATGCTCGTGATTGGTTCTGAGGCGCCCTTCAAGGTCAAGGGG
CTGTGGCTCTTCCGTGGGCAGGACATCCCTGAGTTCGTCATGAAGGAGGTCTATGACATGGAGCTCTACGAGTGGACCAAGGTTGACCTCTCTGACGAGG
CCCAGAAGAAGCGCGTGGAAGCCATGATCGAGGACCTTGAGCCGTTCGAGGGGCAGGCCTTGCTGGACGCCAAGTGCTTCAAGTAAGCGGAGCAGTGCTT
GGGATCGTGACGGTGGCAAAGAACCTATCTAGGACTTGAAATTCAGTGTCGAAACAGTTGGTCTTTTTTTGGAATAGTTTGCTTGTTACTTAATGGCTAT
TTGACCTGGTGAACTAGTTAATTTTGTGCTATGCTAAGAGTTTTTGGGTATCTGGTCCTGCTGTCTCGTTATTCTGCGAGGTTTATACATTTGTGTCCGC
AGATAGAGCCATCTACTACTTCCGTGAATCGTTATATTGCTGCTATTGCTAGCCGCTAACTGTTTCTGATCATAGCATGTATGGCCTTCATAGCATGATA
CACAATCTATCAGTGTATCATGAGTCAGCGGTCATTGTCGCCATCGTGGTCTGGCTAACAGCTACTCCCGTAAGACG
page-top