Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4421  (registered. 2012)
Contig Information
Length 753 bp
Clones alternative view 112 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 9
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Wh_SH - 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 9
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 12
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 18
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|113172|sp|P15543.2|ACP3_HORVU|ACP3_HORVU RecName: Full=Acyl carrier protein 3, chloroplastic; AltName:"
Score 251
Evalue 7.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4421
GCACGAGGCCCACCCCACCCACCCAGTCCATCCCCCGTCGCCCTCACGCTCTTCGTGCTCGCCGCCTCCCTTCGCGTGCTGCCTCATGGCTTCCATCGCC
GGATCTGCCGTGTCCTTCGCCAAGCCCGTCAAGGCAATCAACACGAACTCGCTCTCTTTCTCTGGTCCAAGGAGGGGCAATGCATTTCTTCGCCTGCAGC
CAGTGCCGATGAGATTTGCTGTTTGCTGCTCAGCAAAGCAGGATACAGTGGAGAAGGTTTGTGAAATTGTTAAGAAGCAGCTTGCTGTTCCTGAAGGCAC
TGAAGTTTGCGGTACCACCAAGTTCTCTGACCTTGGAGCTGATTCACTGGACACGGTCGAGATTGTGATGGGCCTCGAGGAGGAGTTCCAGATCAGTGTG
GAGGAGACGAGTGCGCAGGCAATTGCGACAGTTGAAGATGCTGCCACGCTCATCGACAAGCTTGTCTCTGCGAAGTCATCTTGAAGGGAGGTCGTAAATC
GTAATGATTGGAGCTCGTAAGCTAGTAGTCCTACCTTGGGTTGATCCTTGTTGTTCTACCATAGTCGTTATTATATGGTGGGTTGGTGATTTTCTCAGGA
CTATCGTCTCCTGCTGTGTGTAATAAGATAATTGGTTAAGTATGTAAGCTGTTGAACATCGAAGTGCCTAGTTTTCGTGCGGCTGTGGTGCATGTATGCA
TCTTTTGTGCCCAAAAGGAAGAATATGCGGGTACAAGCCAACTAAAAAAAAAA
page-top