Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7068  (registered. 2002)
Contig Information
Length 642 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0614600 [Oryza sativa (japonica cultivar-group)] >gi|33340007|gb|AAQ14479.1|AF297651_1 putative aminotransferase [Oryza sativa] >gi|38344251|emb|CAE04333.2| OSJNBa0008M17.4 [Oryza sativa (japonica cultivar-group)] >gi|113565434|dbj|BAF15777.1| Os04g0614600 [Oryza sativa (japonica cultivar-group)] >gi|215717129|dbj|BAG95492.1| unnamed protein product [Oryza sativa Japonica Group]
Score 827
Evalue 8.05441e-87
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig7068
gccctCCCCCTTCGCCTCTCGCTCTGTATTTCTCCTCTCCGACGGAAACAGCCATCTCTGATCCTCCCGTGTCACCGCCGAGATGATTGCGCGCGGCCTG
CTCCGATCCAATGCCTCATCGCAGGCAAGCAAATTTGTGAAGTATTTAACCAGCGCCGGGGGCTTACAAGGGCATGCAGAGAGCTTGTCAGATGCATCAG
TCAGACATTTCAGCTCAGCATCGTCTCCTCAGACGAACTCAACTGAAGAAAATGGGTTTAAGGGGCATGGCATGTTGGCACCATTCACAGCTGGATGGCA
GAGCAATGATGTGCATCCGCTGGTTATTGAGAGATCTGAGGGGTCTTATGTTTATGACATCAACGGGAATAAGTATCTAGATTCTCTAGCAGGACTCTGG
TGTACAGCTTTAGGTGGTAGTGAGCCTCGATTAGTCAAAGCTGCAACTGACCAATTAAACAAGTTGCCCTTCTATCACTCCTTCTGGAACCGTACAACCA
AACCAACATTGGAT*CTTGCAG*ACGACCTTCTTAGCATGTTTACTGCAAGCAAAATGGGAAAGGCATTCTTCACAAATAGCGGTTCGGAAGCAAATGAC
TCACATGTCAAACTGGTATGGTATTATAACAATGCATtgggg
page-top