Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6797  (registered. 2002)
Contig Information
Length 596 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_29035 [Oryza sativa Indica Group]
Score 172
Evalue 6.03192e-11
Total Hit Count 209
Registered year 2002
Contig Sequence     [ Download ]
>Contig6797
gcaagcattggtaagcttacaaaattgcggcgtctgcttattaacagatccacagaagtaccagataagatcattgggaaactagAAGCTCTAGAAGAAC
TGGTGGGCATTGATATCTCCAAGTCTCCAAATATTCTGCAAGAGATTGGTACCATGCCAGAACTGAGGGTGCTCAGCATTGCCTTGTGGTCGTGGGATGA
GCATCATACCACACTTCTCTCCCAGATTATCTGCAAACTGGCTATGAAGAAACTCAGACATCTCTCTATCTGCTCTTGCTGTTTACTAGATTTGAAGCCA
GATTTGAAGCCAGATCTGCAGCCGGTTCTCCAACTGGAAAAGCTTGAGATACAGGGCAGCATATTCGAGAAATTACCAACGTGGATTAACGGACTCACCC
ATCTCCGCTCCTTGTCCATCGAGATCTACTCCTTGGAAAATAATGCCCTTGAAGTACTTGGGGAATTAGAGCTTCTTTTCCTATCCCTTgttgcaaagag
gacctcaggagaaaagttggtgattatgacaaataaattctgtaccctggaaactttccttctgttcagccgtgccacagcaatcgagtttgaaca
page-top