Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6793  (registered. 2002)
Contig Information
Length 548 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0118400 [Oryza sativa (japonica cultivar-group)] >gi|38344860|emb|CAE01286.2| OSJNBa0020P07.3 [Oryza sativa (japonica cultivar-group)] >gi|113563628|dbj|BAF13971.1| Os04g0118400 [Oryza sativa (japonica cultivar-group)] >gi|116308871|emb|CAH66007.1| H0613H07.5 [Oryza sativa (indica cultivar-group)] >gi|119395218|gb|ABL74570.1| elongation factor [Oryza sativa (japonica cultivar-group)] >gi|125589153|gb|EAZ29503.1| hypothetical protein OsJ_012986 [Oryza sativa (japonica cultivar-group)] >gi|215704910|dbj|BAG94938.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215715300|dbj|BAG95051.1| unnamed protein product [Oryza sativa Japonica Group]
Score 635
Evalue 9.99139e-65
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig6793
ttcggcacgagggtACGTTTCCAagnatGGTCCCAGCATCTGATGTGGGCAGATTTTTCGCGTTTGGTCGTGTCTTCTCCGGAAGGATTGCAGCTGGCAT
GAAGGTCCGGGTCATGGGGCCTTCCTATGTCCCCGGCATGGAAACTGATTTGCACGTGGAGTCTGTCCAGCGTACCATTATATGGATGGGAAAGAAGCAA
TGTGACGTTCCGGATGTTCCTTGCGGTAACACTGTTGGTTTGATTGGTCTGGATGCATGCATAACAAAGAGTGCTACCCTGACAAGCGAGAAGGAGGTTG
TTGCACGCCCAATCAGAGCGATGAAGCTCTCTGTATGCCCTCTGATGTTTGTTACAATTAACTGCAAGGTTCCGTCTGAGTCTCCCAAACTTGTACAAGG
TTTGAAGCGTCTGGCGATGTCTGATCCCGTGGTTCTGTGGAGCAAGGTAGAGCCTGGTACTTACACAGTTGCTGGAGTGGGAGAACTTCATCTGGAAATT
TGCTTGAAGGATCTACAGGAAGAGTTTATGGATGGTGTTGAAGTTgtt
page-top