Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4381  (registered. 2012)
Contig Information
Length 539 bp
Clones alternative view 99 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 10
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 10
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 6
WH_XA Root 5
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 20
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig4381
TTTTTTTTTTGGTATGAAAACGAGGAATATAAAATTAGAGCATCAAAACAAAGCATGGTCGGCCTTCGCAAAATAATAAAAATATAAGGATGCAGAGCAA
CTTTCTAACCAGAATGGCACAAGAGTAACAGAATTATCGGTTTCACATGCTCAAACAGCAGTCACTAACTTTGTTTCACGGTTTTGTCACCAGGATTCAA
ACATAATAGCAGTTCATTACATAGCTTATAGGATAAAGATCAGCCTCGATGAAGCACCACAGTTCGTTGATAATTTCCTAGTCCTTGCTTCCTTTGAGGT
TTCCATTCTTAACGGTACTTGATGAAGCCAATGTCCTTGGCGTTGCTGCGGAAGCACTGCCTGCAGCACATCAGCCCGTACTTGCGGATCAGGCCATGCG
AGTTGCCGCAGACACGGCAAACCCTCGATCCGGGGCCGTAGTTCTTGGGGTGCGAGTTCCAGACGTTCGAGTGTCCCATGGCGGCGGCGGCGGCGGCGCG
GCTTGCAACTGGAAACCCTACCTTTTGCTCTCGCCTGGC
page-top