Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4368  (registered. 2012)
Contig Information
Length 827 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XB Root 2
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464175|ref|NP_001055687.1|| Os05g0446300 [Oryza sativa (japonica cultivar-group)]
Score 308
Evalue 4.00E-82
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4368
CCACGCTAGACCGCCCGCTCCTGCCAAGATCCAACACAACTTTCCGCCCCCTCGTCCGGTCGTCGGGCCGTCGCCGCCGAACACCGCCCCCCTCCACCGA
AGCGCGGCAGCTCGAAGGTTCGTGTTCTAATAAGCTTATTCCCTTGAGGCAGCATGCCTAAGATAAAGACGAGCCGTGTGAAGTATCCTGAAGGATGGGA
GCTTATTGAACCAACTCTCCGTGATTTGGAAGCCAAAATGAGAGAAGCTGAGAATGATACACATGATGGGAAGAGGAAGTGTGAGGCTCTCTGGCCAATC
TTCCGTATTTCTCACCAAAAGAGCCGTTATATATATGATCTCTACTATCGAAGGAAGGAGATAAAAAAGGAGCTGTATGAGTTTTGCTTGGACCAAGGTT
ATGCAGACAAAAATCTGATTGCTAAGTGGAAAAAGCCAGGTTATGAGCGTCTCTGCTGCCTCCGCTGCATACAGACACGAGACCACAACTTTGCAACCAC
CTGCGTCTGCAGGGTCCCCAAGCACCTCAGGGAAGAGACGGTGATAGAATGTGTCCACTGCGGATGCAAGGGGTGTGCCAGCGGCGATTGAAGTCGCCAC
TCGTTGTTAAGAATAATCTGAAACCGATTGCTCGAGATGCTCTGTTGGATCCCTGATGAATGAATGAAAACAAGTAACGTACAATCAGGTGATTCGTCCA
TATATTCACTGTAAACTCTCGAGCCGTGGTATGTATTTGCGTGAGAAGACTCGGTTTTCTGCCGTGGAAGTTGACAACTGTTTCGCTGAGAATGTTATGT
TAACCCGATCTTCCATGATGGATCACA
page-top