Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4335  (registered. 2012)
Contig Information
Length 1252 bp
Clones alternative view 27 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 3
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 1
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115452247|ref|NP_001049724.1|| Os03g0278200 [Oryza sativa (japonica cultivar-group)]
Score 588
Evalue 5.00E-166
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4335
TAAAAGTCTTGTCTGCCAATACAAACTTCAGATATGAAAACCAAGAAAAACAACACGTAAACAGGATGCACAAGCGCAGCATCATGCACATGAAAGGCAC
CTGATAAATAGAAACAAGATTTTAAGATCTGTTCTCATAGATAACCAGGCCAGCAAACATATCCACCACTACATAGAACATCTGATAATACTCAAGTGAA
ACATAACGCGTAACAAAAAATGGTAAATATGTATGCATGCTATACCACAATAAAATTGACCACAGCTGCCACCGTGCAATATATTAGCTAATTAGAAATA
GCTTATAGCAGACCTGTGTCACATGAATCCTCAATTAGTAGACACCTTCCTGTTTGGCTCAAAGACATTCCTGATCAAAGATTCCTTAATGGACAGTAGC
TCAGGGAACTCGGACTTCAGCTTTGACGCGTCCATTTCGTTGTTGCTTCTTGGTGCAACTATAACCTTGGCCTGCTCTTCGAGCGTGAAGTTGGTCCACT
TGAAGTCCGGGTTTATGTATTCCTTGTACATCTCCAGAATCTCGTTGTGACTGACAACCCCTGGGTTGGTGAAATTCCATATGCCCCTACAATCCCGCTT
CGCCATCTCAACAGAGATAGGCAACAATTCATCCAAAATTGTCATACTGTTCGGAATGTTCACCACCTTGTCATAGCGGGCTATTTTTGTGATGAAGTTA
CGAGGATTGCTCAGGTCTGATGATATGGGCATCCTGACTCTAAGAGTACAGACATTATCATAGTCCTTCAATAACTCTTCCACCATGGCTTTGGTTTTGG
AATAAAATGAACCTACAAAGTTGGGCGTGTCCTCCTCTTTAAAACCAATTCCAGACCCTTCAGGGTGTTCAGCATTATACTCAAATATGCAACCTGTAGC
ATAATTAATCATGAGCAACCCCTGCTCACGACAAACATCAGCAAGATTCAAGGTGCCTACAACATTGGTGCGGATAGTGTCCTGTTTGTGGGTCTCACAC
CAGTCAACATTTGGCCTTCCAGTGACACCAGCAGCATTGAAAACATGAGTCGGCTTCACATTTCTAATGTCCTGCAAGAGCTGAGAGCGCTCTTGCAGGC
GCCCTTTACCATATTCATAAGGTATGCCTTGCTTCTCACATATCTTCCCAAGTAGGCCACCAATCCATCCAGTCTTGCCATATATTAAGAACTTGTAGGT
GGCCTTTTGAGGGACACTGCTGGTACTCTTGGATGTGGCTGCAGCAGGTACT
page-top