Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4331  (registered. 2012)
Contig Information
Length 1117 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 5
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 8
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XA Root 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig4331
TGAGCACATAACGATGAATCTGGAATATTACAACACCTTAGTCAAAGTTTAAAATATCTTACAAAAGCATTAACGTAATCCTCATATGCTCACGGTTAGC
TTATTATGCATACGCCCTCCGTCCTAAAATACTTGTCATCAAAATGGATCAAAAGAGATGTATCTAAAACTAAAATACGTCTAAATACATCTCTTTTATC
CATTTCGATGACAAGTATTTCCGGACGGAGGGAGTATGTTTTATTAGCAAGAAGGACAACATCCAAGTCCTAGTATGCAACCGTTGGCAGAAGCACAGCT
TAGTAGCAGTAATGATAGCACCACTAGATGTAAGTAGGGTATCGGTATGGAGGGTTGGTGGTCGCTTCCAGCTCGACCCATTCAGGATTGGTGGTGATGG
TTTCCACATCAACTCCCTTTGGTAAATGAACATACAGTCTGCCATGAACCACCTTATAATCAGCGAAGACTCGCTTGAGAAGTTTGTCACCATCACCTAG
AATAAATTCACCTGGTTTGTCGCCAAACTCCTCATCAATCTTTTTAAGAATAGGATCATGACAGCAACAGAGCTTCCTTAGCTTCCCATCCGCGAATTTG
TTTATTCCCAATTTGTAGGGCAGATTAGCATTGTTCCGACGGTGGACAAGCAGGACAGTCTCCTTGAATGTGTTGAACCAGTGAACCATCTCATCATGAT
CACGCTTTTGGTTGAAATCTTTGCACCAGCGCTCATACAAGGCCCAAAGGGCTGCTTCTGACTCAAGGTCTTTCTCCTCTACCACAAACTTCACCTTACC
TTCCTGCCTTTGTTCTTCTGGGTGACTGAGTGTCAGGGAGGCAGGTGCCATGGCGCGTGGAGGAGCATGGACAGTGGATTGGTTCATACGCAGATCTACG
GAGGCGGCACGATCTGAACCTAAGATAGCGTGAGGTTTGGTCGCCACCGCCTTCGTGGAGAGGGTCGCTGCTTCAACGAATTGGGCGAAGCGAGATGTGG
TCGCCGCAGCTGAGCGAGCGGCACGGCCGATCCGCACGAGTCGGGAAGCTGCTGAAGGCATGGTGAAAGATAACGAGGAAGGACCTGGATCTGGATGGTG
GCGACCAGTGTCGGCGT
page-top