Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4330  (registered. 2012)
Contig Information
Length 1739 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 9
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 11
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115452223|ref|NP_001049712.1|| Os03g0276500 [Oryza sativa (japonica cultivar-group)]
Score 1079
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4330
GATCCAACCAATCCCGCAATTCCCTTCGAGGTTGTTTCTCCGCTCGACTTGTCGACGAGATCATGGCCGGAAAAGGAGACGGGCCGGCGATCGGCATCGA
TCTCGGCACCACCTACTCCTGCGTCGGCGTCTGGCAGCATGACCGGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACGCCGTCCTATGTCGCC
TTCACCGACACCGAGCGGCTCATCGGCGACGCCGCGAAGAACCAGGTCGCCATGAACCCGATCAACACCGTCTTCGATGCGAAGCGGCTCATCGGTCGGC
GTTTCTCGGACGCGTCGGTGCAGAGCGACGCCAAGCTGTGGCCGTTCAAGGTGATCCCAGGCCCCGCTGACAAGCCGATGATCGGGGTACAGTACAGAGG
CGAGGACAAGCAGTTCTCGGCCGAGGAGATCTCCTCCATGGTGCTCAACAAGATGAAGGAGACGGCCGAGGCCTACCTCGGCACAACCATCAAGAACGCA
GTCGTCACCGTCCCCGCCTACTTCAACGACTCCCAGCGCCAGGCCACCAAGGATGCAGGCGTCATCTCTGGCCTCAACGTCATGCGGATCATCAACGAGC
CTACCGCCGCCGCCATCGCCTACGGTCTCGACAAGAAGTCCACCAGCGTCGGCGAGAAGAACGTGCTCATCTTTGATCTCGGCGGCGGTACCTTCGATGT
CTCGCTCCTCACCATTGAGGAGGGTATCTTCGAGGTCAAGGCCACTGCCGGAGACACCCACCTGGGAGGCGAGGACTTCGACAACCGGATGGTCAACCAC
TTCGTGCAGGAATTCAAGAGAAAGAACAAGAAGGACATCAGCGGCAACCCGAGGGCGCTCCGGCGGCTCAGGACAGCGTGCGAGAGGGCGAAGAGGACAC
TCTCCTCCACCGCCCAGACCACCATCGAGATCGATTCCCTCTTCGAGGGCATCGACTTCTACACTACCATCACCCGCGCCCGGTTCGAGGAGCTCAACAT
GGACCTCTTCCGCAAGTGCATGGAGCCCGTTGAGAAGTGCCTCCGGGACGCCAAGATGGACAAGAGCACCGTGCACGATGTTGTCCTCGTCGGAGGATCC
ACACGTATCCCCCGTGTGCAGCAGCTCCTCCAGGACTTCTTTAACGGGAAGGAGCTCTGCAAGAGCATCAACCCTGACGAGGCCGTCGCGTATGGAGCCG
CCGTTCAGGCTGCCATCCTCACTGGCGAGGGCAACGAGAAGGTGCAGGACTTGCTCCTGCTTGACGTCACACCGCTCTCGCAGGGCCTGGAGACGGCCGG
AGGTGTCATGACCGTGCTGATCCCAAGGAACACGACAATCCCCACCAAGAAGGAGCAGGTCTTCTCCACCTACTCTGACAACCAGCCCGGCGTGCTCATC
CAGGTGTATGAGGGCGNNNGGGCGAGGACCAAGGACAACAACCTGCTCGGCAAGTTCGAGCTCTCCGGGATCCCACCGGCGCCCAGGGGTGTCCCCCAGA
TCACCGTGTGCTTTGACATTGATGCCAACGGTATCCTGAATGTCTCGGCGGAGGACAAGACCACCGGACAGAAGAACAAGATCACAATTACCAACGACAA
GGGGCGGCTGAGCAAGGAGGACATCGAGAAGATGGTGCAGGAGGCCGAGAAGTACAAGGCTGAGGACGAGGAGCACAAGAAGNNNNTGGACTCCAAGAAC
GCCCTGGAGAACTACGCTTACAACATGCGTAACACCATC
page-top