Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4328  (registered. 2012)
Contig Information
Length 741 bp
Clones alternative view 44 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XF Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108863914|gb|ABG22330.1|| Macrophage migration inhibitory factor family protein, expressed"
Score 218
Evalue 7.00E-55
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4328
TTTTTTTTTTTTTCACGGACACCACAAAGGGTTCATGATTACGAATCGAACCAAGCAGTTGCAACATTCCCTTGCCATGGCAAGTCCGAAACCAAACCAA
CTAGATCACACAAGTACTCCGGCACTCATAAACACTGGCCATTAAACTGACACGATGTCTTACTGCAGCAGTTTCTCCTTAAATAGGCAATGGACAGAAT
ATTAGGAACTCTGGAGTTCATGCAAGGCTCCATGCCATATGATGCGTCTAAAAGGTGGATCCATTCCATCCAAAGTCTGAGCGCTTTGAATCGTGGAACT
TGAGGTAGAAGCGGGACTTGGGGATGGACAGCTTTGACTCCAGGATGGAAGCAATGCCGGCGCTCAGCTTCTTGTTCACATCAGCGTTCAGCCCTCCGAT
GGAAACCAGCTCGCCGTAGGCTGCAGGCTCCTGGGTACCTCCAAATGCCATGGGCACTGAACCCTTGAGAACAACCATCACATAGGCCTCCGGCTTGCCG
ATGATGGTTGCGACGGTGCTGGAGGCGTCGGCGAGGACGGCGGAGGTGTCCACCCCCTCCAGGTTCACGTTCGTCGACACGTTCAGGCAAGGCATCTTCC
TCCCCCTCCGCTTCTTCTTCTTCTTCTTCTCCCCTCTCTGCGCCTTTGGTGGATGGGTGGGGAAGTACCTAATGCAGAGTTGGAGACCAATATGACATCA
ATCTTTCCTGACGTCAATATTAATTTGTTTGGGATTCATGT
page-top